ID: 953011332

View in Genome Browser
Species Human (GRCh38)
Location 3:39028037-39028059
Sequence AGGGTTTTCTGTAGACTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953011332_953011341 15 Left 953011332 3:39028037-39028059 CCATCTAGTCTACAGAAAACCCT No data
Right 953011341 3:39028075-39028097 CCCTCCCAAATAAAAAACTGTGG No data
953011332_953011343 16 Left 953011332 3:39028037-39028059 CCATCTAGTCTACAGAAAACCCT No data
Right 953011343 3:39028076-39028098 CCTCCCAAATAAAAAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953011332 Original CRISPR AGGGTTTTCTGTAGACTAGA TGG (reversed) Intergenic