ID: 953011479

View in Genome Browser
Species Human (GRCh38)
Location 3:39029519-39029541
Sequence GGGAAAGGACATAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953011470_953011479 -2 Left 953011470 3:39029498-39029520 CCAAACAGATTTTCCCATAGTGG No data
Right 953011479 3:39029519-39029541 GGGAAAGGACATAGTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953011479 Original CRISPR GGGAAAGGACATAGTGGGCA GGG Intergenic
No off target data available for this crispr