ID: 953013889

View in Genome Browser
Species Human (GRCh38)
Location 3:39053850-39053872
Sequence CAGTGCACGTAGAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953013886_953013889 -3 Left 953013886 3:39053830-39053852 CCAATAGGCTGAATGTGAGCCAG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 953013889 3:39053850-39053872 CAGTGCACGTAGAATGAGGCAGG 0: 1
1: 1
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953013889 Original CRISPR CAGTGCACGTAGAATGAGGC AGG Intronic
900812465 1:4817387-4817409 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
905356424 1:37388113-37388135 CAGTGCAGGTAGCATGAGGAGGG - Intergenic
906990029 1:50727775-50727797 CAGTGCAGCTAGAATAAAGCAGG + Intronic
907701930 1:56797238-56797260 CAGTGCACAGTGTATGAGGCTGG + Intronic
907720403 1:56966877-56966899 GAGTGCACATAGAATGTGCCAGG - Intergenic
909759942 1:79273672-79273694 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
911642979 1:100308457-100308479 CAGTGCATCTAGAATAAAGCAGG - Intergenic
914901198 1:151712054-151712076 CAGGCCACGAAGAAGGAGGCTGG - Intronic
918586539 1:186194685-186194707 CAGTGCACTTAGAAGCAAGCAGG - Intergenic
922651409 1:227342225-227342247 CGGTGCAGGTAGAATAAAGCAGG - Intergenic
924931903 1:248739620-248739642 CAGTCCCCGAAGAAGGAGGCTGG + Exonic
1063014050 10:2057225-2057247 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1068261951 10:54594493-54594515 CAGTGCAGGAGCAATGAGGCAGG - Intronic
1071804731 10:89105602-89105624 CAGCGCAGCTAGAATGAAGCAGG - Intergenic
1074350506 10:112732424-112732446 CACTGCACAGAGAATGGGGCAGG - Intronic
1077552797 11:3208870-3208892 CAGTGCAGGTGGAATGACACAGG + Intergenic
1082932958 11:58628227-58628249 CAGTGGAGGTGGGATGAGGCAGG - Intergenic
1083529975 11:63411249-63411271 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1084753345 11:71218841-71218863 CAGTGCTGGAAGAACGAGGCTGG - Intronic
1089197967 11:116706259-116706281 CTGTGAAGGTAGACTGAGGCGGG + Intergenic
1091346315 11:134856688-134856710 CAGTGCACGTAGAATGTGGCTGG + Intergenic
1093328809 12:17810927-17810949 TGGTGCATGTAGAATGAGGCAGG - Intergenic
1093593250 12:20931766-20931788 GAATGCACTTAGAAGGAGGCTGG - Intergenic
1096502183 12:52070719-52070741 AATAGCACGTAGAATGAGGGAGG + Intronic
1097191407 12:57221253-57221275 CCCTGCACCTAGAAAGAGGCAGG - Intronic
1097371142 12:58782882-58782904 CAGCGCAGCTAGAATAAGGCAGG + Intronic
1100796246 12:98184834-98184856 CAGTTCACGTAGAGGGATGCAGG - Intergenic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1109713126 13:66184633-66184655 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1110274244 13:73625761-73625783 CTCTGCACATAGAATGAGACGGG + Intergenic
1111181228 13:84668560-84668582 CAGTGAACATAAAGTGAGGCAGG + Intergenic
1112018916 13:95354594-95354616 CAGAGCAGGTAGAATGTGGAAGG - Intergenic
1113068284 13:106393478-106393500 CAGTGCTGCTAGAATAAGGCAGG + Intergenic
1113090372 13:106611822-106611844 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1113096233 13:106666884-106666906 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1114667371 14:24387251-24387273 GAGTGTTCGTACAATGAGGCTGG + Intergenic
1114790787 14:25656010-25656032 CAGTGGAAGTAGAATAAAGCTGG + Intergenic
1115287625 14:31733253-31733275 AAGAACACGTAGTATGAGGCAGG - Intronic
1117001831 14:51377979-51378001 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1117491314 14:56250681-56250703 CAGTGCAGCTAGAATAATGCAGG - Intronic
1118819546 14:69336087-69336109 CAGCCCACGTGGAGTGAGGCAGG - Intronic
1122667435 14:103341761-103341783 CATTGCACGTTGGATGAGCCAGG + Exonic
1124006854 15:25801502-25801524 CAGAGCACTGAGAATGAGGGCGG + Intronic
1127402372 15:58602334-58602356 GAGTGCAAGTAGGATGAGGAAGG - Intronic
1127647695 15:60974617-60974639 CAGTGCACGTGGAATGAATGAGG - Intronic
1128692075 15:69732359-69732381 CAGTGCACGTGCAACAAGGCAGG + Intergenic
1131311620 15:91295878-91295900 CACTGCAAGTGGAATGAGGCAGG - Exonic
1134384704 16:13760773-13760795 CTGAGCACATAGAATGAGGTGGG - Intergenic
1138033887 16:53583058-53583080 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1139032488 16:62901894-62901916 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1148995822 17:51708711-51708733 CAGTGCAGGTAGAATAAAGCAGG + Intronic
1150545330 17:66151270-66151292 CAGTGAACATAAAATAAGGCAGG - Intronic
1151174461 17:72275668-72275690 CAGTGCAGCTAGGATGAAGCAGG - Intergenic
1151180093 17:72321029-72321051 CAGTGCAGGAAGCATGATGCTGG + Intergenic
1154112180 18:11579538-11579560 CAGTGGACGTGGAGTGAGGCTGG - Intergenic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1157021456 18:43787850-43787872 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1158946087 18:62448090-62448112 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1159136393 18:64341896-64341918 CAGTGCAGGTAGAATAGAGCAGG - Intergenic
1159151601 18:64530163-64530185 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1164880167 19:31726268-31726290 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
925342810 2:3148651-3148673 CACTGCTCTTGGAATGAGGCAGG - Intergenic
925673647 2:6337798-6337820 CAGTGCAAGGAAATTGAGGCGGG - Intergenic
926161640 2:10494115-10494137 CAGTGCCTGTGGACTGAGGCTGG + Intergenic
927350026 2:22100190-22100212 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
927371022 2:22355428-22355450 CACTGAACTTAGAAGGAGGCTGG - Intergenic
927695649 2:25238001-25238023 CAGTGCACGCATAAAGAGTCGGG - Intronic
932956998 2:76363857-76363879 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
933790245 2:85878399-85878421 GAATGCACCTTGAATGAGGCTGG - Intronic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
937876685 2:126831317-126831339 AAGTCCATGTAGAATGAGGCTGG + Intergenic
941273327 2:163458181-163458203 CGGTGCAGCTAGAATGAAGCAGG + Intergenic
942661390 2:178268955-178268977 CAGTGCACATACAATCATGCAGG - Intronic
943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG + Intronic
945743381 2:213690650-213690672 CAGTGCAGGTAGAACAAAGCAGG + Intronic
947067206 2:226241116-226241138 CAGTGCATCTAGAATAAAGCAGG + Intergenic
948313799 2:237011231-237011253 CCGTGCATGTAGAAAGAGCCAGG + Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1172346051 20:34200581-34200603 CATTGCACGTTGGATGAGCCAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174113185 20:48210302-48210324 CACTGCACGTGGAGGGAGGCGGG + Intergenic
1176195468 20:63834822-63834844 CAGAGCACCTGGAATGGGGCTGG - Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1178159422 21:29894488-29894510 CAGTGCAGCTAGAATAAAGCAGG - Intronic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1182535043 22:30994760-30994782 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1184921971 22:47612429-47612451 CACAGCAGGTAGAAAGAGGCAGG + Intergenic
949851068 3:8421046-8421068 AAGTGCAGGTGGACTGAGGCTGG - Intergenic
950665026 3:14490120-14490142 CAGTACACATAGAGAGAGGCAGG - Exonic
953013889 3:39053850-39053872 CAGTGCACGTAGAATGAGGCAGG + Intronic
955788931 3:62568373-62568395 CAGTGCAGCTAGAACGAAGCAGG + Intronic
957951425 3:87132188-87132210 CAGTGCAACTAGAATAAAGCAGG - Intergenic
963949428 3:151182650-151182672 CAGTGTAGGTAGAATGTGGCTGG + Intronic
967225500 3:187287304-187287326 CAGGGCACATGCAATGAGGCTGG - Intronic
974137995 4:57843972-57843994 CAAAGCACGTGGAAAGAGGCAGG - Intergenic
976045320 4:80940072-80940094 CAGCGCACATAGAATGAAGAGGG + Intronic
980475145 4:133304652-133304674 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
982530943 4:156542846-156542868 CAGCGCAGGTAGAATAAAGCAGG - Intergenic
982894572 4:160902552-160902574 CAGAGCACCTAGAATAAGGCAGG + Intergenic
983415171 4:167443275-167443297 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
983531521 4:168814382-168814404 CAGTGCAGGGACAATGAGGGTGG + Intronic
988005235 5:25402103-25402125 CAGTGCATGTAGAATAAAGCAGG + Intergenic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
1001586161 5:172834831-172834853 CAGGGCACCTGGAATGAGTCCGG + Intronic
1003041905 6:2696115-2696137 CAGTGGATGTAGAATGACACAGG + Intronic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1007322334 6:41036797-41036819 CAGTGAAGCTGGAATGAGGCAGG + Intronic
1009263894 6:61530114-61530136 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1009711676 6:67330222-67330244 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1010617654 6:78031970-78031992 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1011105573 6:83776494-83776516 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1012158310 6:95849056-95849078 CAGCGCGGCTAGAATGAGGCAGG - Intergenic
1018534718 6:164807893-164807915 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1018707862 6:166476041-166476063 CACTGCAGGTATAATGAGTCCGG + Intronic
1026507886 7:71002128-71002150 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1026978050 7:74510663-74510685 CTGAGCACGTAAAATGAGGCTGG - Intronic
1028555911 7:92124821-92124843 CAGAGCAGGTAGAAACAGGCAGG + Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1030360199 7:108587636-108587658 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1030570156 7:111212885-111212907 CAGAGCACATGGAATGAGACCGG - Intronic
1032730612 7:134638511-134638533 AAGTGCAAGTAGAATGAGTAAGG - Intergenic
1036017122 8:4797325-4797347 GAGTGCACCTGGAATGAAGCAGG + Intronic
1037892050 8:22628688-22628710 CATGGCTGGTAGAATGAGGCAGG - Intronic
1040705461 8:50121360-50121382 CAGTGCACATAGAACTAGGTAGG - Intronic
1041125886 8:54637975-54637997 CAGTTCACGTCGGATGAGGAGGG - Intergenic
1049417308 8:142500974-142500996 CAGTGCAAGCAGAACCAGGCTGG - Intronic
1050085483 9:1960468-1960490 CAGTACACGTAGAAACAGTCTGG + Intergenic
1050698839 9:8313398-8313420 CTGTGAAAGTAGAATCAGGCTGG + Intergenic
1052835052 9:33244243-33244265 CAGTGTATGTAGAAAGAGTCAGG + Intronic
1058381305 9:104379830-104379852 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1059426163 9:114222257-114222279 CAATGTACTTACAATGAGGCCGG - Exonic
1188485719 X:30679679-30679701 CAAAGCACGTAGAATGGGGGAGG - Intronic
1191226139 X:58045087-58045109 CAGCGCACCTAGAATAAAGCAGG + Intergenic
1191226750 X:58052157-58052179 CAGTGCAGCTAGAATGACGTAGG + Intergenic
1193461741 X:81798271-81798293 CAGTGCAACTAGAATAAAGCAGG + Intergenic
1194744347 X:97612040-97612062 CAGGGCACGTGGCAGGAGGCAGG + Intergenic
1197845643 X:130799153-130799175 TAGTGCACCTAGAATTAAGCAGG + Intronic