ID: 953015461

View in Genome Browser
Species Human (GRCh38)
Location 3:39071453-39071475
Sequence TCATCTCCATGGTTTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953015459_953015461 -2 Left 953015459 3:39071432-39071454 CCAGGATTGGGCGGGATCATATC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 953015461 3:39071453-39071475 TCATCTCCATGGTTTCCAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 265
953015452_953015461 22 Left 953015452 3:39071408-39071430 CCCGTGTCTCTTCAGTTAGCTTT 0: 1
1: 0
2: 1
3: 29
4: 333
Right 953015461 3:39071453-39071475 TCATCTCCATGGTTTCCAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 265
953015453_953015461 21 Left 953015453 3:39071409-39071431 CCGTGTCTCTTCAGTTAGCTTTG 0: 1
1: 0
2: 2
3: 25
4: 268
Right 953015461 3:39071453-39071475 TCATCTCCATGGTTTCCAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953015461 Original CRISPR TCATCTCCATGGTTTCCAGA AGG Intronic