ID: 953015461

View in Genome Browser
Species Human (GRCh38)
Location 3:39071453-39071475
Sequence TCATCTCCATGGTTTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953015459_953015461 -2 Left 953015459 3:39071432-39071454 CCAGGATTGGGCGGGATCATATC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 953015461 3:39071453-39071475 TCATCTCCATGGTTTCCAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 265
953015453_953015461 21 Left 953015453 3:39071409-39071431 CCGTGTCTCTTCAGTTAGCTTTG 0: 1
1: 0
2: 2
3: 25
4: 268
Right 953015461 3:39071453-39071475 TCATCTCCATGGTTTCCAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 265
953015452_953015461 22 Left 953015452 3:39071408-39071430 CCCGTGTCTCTTCAGTTAGCTTT 0: 1
1: 0
2: 1
3: 29
4: 333
Right 953015461 3:39071453-39071475 TCATCTCCATGGTTTCCAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953015461 Original CRISPR TCATCTCCATGGTTTCCAGA AGG Intronic
900320308 1:2080240-2080262 TCATCACGATGGTTTCCAGGTGG - Intronic
900502212 1:3011860-3011882 ACACCTCTCTGGTTTCCAGATGG - Intergenic
903695555 1:25203966-25203988 TCATCTTCATTGATTACAGATGG + Intergenic
906172167 1:43735589-43735611 TCTTCTCCAGGGCCTCCAGAAGG + Intronic
907299659 1:53478647-53478669 CCATCACCGTGGTTTCCTGAGGG + Intergenic
907847088 1:58218748-58218770 ACCTCTGCATGTTTTCCAGAGGG + Intronic
908549397 1:65193688-65193710 TCATACCCATGGGTTCCACAGGG - Intronic
908799738 1:67867006-67867028 TCTTCTCTATGTTTTCCAGATGG - Intergenic
909669166 1:78168819-78168841 TCTTCTCCATGGTGTCTGGATGG + Intergenic
911571077 1:99517610-99517632 TCATCTCCAAGTTTACCAGGTGG - Intergenic
912547413 1:110460929-110460951 CCCTCTCCCTGGTATCCAGAGGG + Intergenic
913486525 1:119336734-119336756 TCATCTTCATGTTTTCGACAGGG + Intergenic
915997483 1:160578191-160578213 TCATCTCAATGGTTTTCATATGG + Intronic
918359414 1:183740393-183740415 TACTCTCCATGGCTTACAGATGG + Intronic
918569182 1:185967760-185967782 TCACCCCTATGGTTTCCATAAGG - Intronic
919006082 1:191901277-191901299 TATTCTCCAAGGTATCCAGATGG + Intergenic
922483379 1:225955044-225955066 CCATCCCCATGGCCTCCAGACGG - Intergenic
922991180 1:229913004-229913026 TCACCACTGTGGTTTCCAGATGG + Intergenic
923378306 1:233389113-233389135 TCACCTCCATGATTTCCATATGG + Intergenic
924447532 1:244147566-244147588 TCTTCTCCATGTTTTACAAATGG - Intergenic
1062957683 10:1551192-1551214 GCCTCTCCATGGCTTGCAGATGG - Intronic
1062961335 10:1575730-1575752 CAAGCTCCATGGTTTCCAGATGG + Intronic
1063133708 10:3198979-3199001 TCCTCTCCATGGCTTGCAGACGG - Intergenic
1066311308 10:34199504-34199526 TCATGGCCATGGTTTCATGAGGG + Intronic
1067431364 10:46248138-46248160 TCATCCCCAGGGTTTATAGAGGG - Intergenic
1067442043 10:46314062-46314084 TCATCACCAGGGTTTATAGAGGG + Intronic
1070674862 10:78405613-78405635 TTTTCTCCATTCTTTCCAGATGG + Intergenic
1071076465 10:81759441-81759463 TCTTCTCCATGGTGGCCAGGTGG - Intergenic
1071254856 10:83862912-83862934 TCATCTCCATGACTTCCTGATGG - Intergenic
1072877439 10:99188031-99188053 TCATATCCATGGTTTCTGCAAGG + Intronic
1073032199 10:100535851-100535873 TCATCTCTATGGTTTCCGTTGGG + Exonic
1073276109 10:102312936-102312958 TCATCTTGATGGTCTCCAAATGG + Intronic
1073935035 10:108621009-108621031 TCTTCTCCAGGGTCTCCAGGTGG - Intergenic
1075378881 10:122002106-122002128 TCATCTTCTTGGTTTGCAGATGG + Intronic
1075899979 10:126033780-126033802 TCATCACCATGGAGTCCAGAAGG + Intronic
1076006122 10:126949163-126949185 CCATCTCCATTGATTCCCGAAGG + Intronic
1076350876 10:129814403-129814425 TCCTCTGCCTGGTTTGCAGATGG - Intergenic
1076737000 10:132463388-132463410 TCTTCTCCAAGGTTGCCAGGCGG + Intergenic
1078195549 11:9133986-9134008 TTCTTTCCATGGTTTCCCGACGG - Intronic
1078910086 11:15723056-15723078 CTATCTCCATAGCTTCCAGAGGG - Intergenic
1079242626 11:18731501-18731523 TCATCTCCATGGCATTGAGAAGG + Intronic
1079703593 11:23583843-23583865 TTCTCTTCATGGTTTGCAGATGG - Intergenic
1080142704 11:28941881-28941903 TCAACCCTCTGGTTTCCAGATGG - Intergenic
1080947847 11:36995072-36995094 TCCTCTCAATGCTCTCCAGAGGG - Intergenic
1082076246 11:47978441-47978463 TCATGTCCATGATACCCAGAGGG - Intergenic
1083705566 11:64511990-64512012 TCATCTCTATGGTTTGCTGAAGG + Intergenic
1084005746 11:66322716-66322738 TCTTCCCCATGGCCTCCAGAAGG - Intergenic
1084428455 11:69098157-69098179 TCATGTCTCTGGTTTTCAGATGG + Intergenic
1084455404 11:69265349-69265371 TCTTCTCCATCCTTTCTAGAGGG - Intergenic
1084793586 11:71490116-71490138 TTCTCTCCAGGGTCTCCAGAAGG - Intronic
1085074567 11:73579019-73579041 TCAGCTTCCTGGTTTGCAGATGG + Intronic
1086894340 11:92294723-92294745 GGATCTCCATGGTTTACAAAAGG - Intergenic
1087564748 11:99840148-99840170 TAATGTCCATTGTTACCAGAGGG + Intronic
1088592949 11:111418972-111418994 TCCTCTCCTTGGCTTCCAGATGG + Intronic
1088904095 11:114140951-114140973 CCAGCTCCATTGTTTCAAGAAGG + Intronic
1089898695 11:121958972-121958994 TCATCTCCAGTGTTTCCATGTGG - Intergenic
1090829433 11:130410764-130410786 TAATGTTCATGGTTTCCAGCAGG + Intronic
1091321337 11:134654540-134654562 TAATCTCCATGGTGCGCAGAGGG + Intergenic
1093146388 12:15571643-15571665 TTGTTTCCATGGTTTCCAAAGGG + Intronic
1093511476 12:19934686-19934708 CCCTCTTCATGGTTTGCAGATGG + Intergenic
1095413929 12:41954723-41954745 CCATCTCCCTGGCTTGCAGACGG + Intergenic
1095985284 12:47995256-47995278 TCATCACCAGGCTTTCCAGGGGG + Exonic
1096263637 12:50107638-50107660 TCATCTCCATGAGTCCCAGCCGG - Exonic
1097496829 12:60350243-60350265 TCTTCTCAATAGTTTCCAGTTGG - Intergenic
1097636969 12:62134439-62134461 CCATCTTCTTGGTTTTCAGATGG - Intronic
1098294055 12:68986079-68986101 ACATTTCCATACTTTCCAGATGG - Intergenic
1098321700 12:69251183-69251205 GCATCTCCATTATTTGCAGATGG - Exonic
1099357316 12:81653753-81653775 TCATCTCCCTGATCTTCAGATGG + Intronic
1101037349 12:100717968-100717990 TCATCTCTCTGATTTACAGACGG - Intronic
1102414759 12:112750955-112750977 GTCTCTCCATGGTTTCAAGATGG - Intronic
1102578261 12:113870917-113870939 ACATCTACATGGTTTCCAGAGGG + Intronic
1103140056 12:118540660-118540682 TCATCTCCTTCCATTCCAGAGGG - Intergenic
1103214546 12:119191503-119191525 TCATCTCCATGGTTCCAATCTGG + Intronic
1106196695 13:27500109-27500131 ACATTTCCAGGCTTTCCAGATGG + Intergenic
1107100306 13:36583151-36583173 TCACCTTCATGGTCTCCAGAGGG - Intergenic
1108180834 13:47838198-47838220 TCCTCTCCTTTGTTTCCTGAGGG + Intergenic
1109359258 13:61274594-61274616 TCATCCACATGGAATCCAGAAGG - Intergenic
1109692890 13:65916185-65916207 TCATCTCCATAGTTTGCATTAGG - Intergenic
1110155295 13:72309469-72309491 GCCTCTCCATGGCTTGCAGATGG - Intergenic
1110266864 13:73547887-73547909 TTGTCTCCATGCCTTCCAGAAGG - Intergenic
1110339933 13:74377878-74377900 GCAACTCCATGTTTTCCAAAAGG + Intergenic
1113230652 13:108210904-108210926 GCATCTCCATGAGTTCCAGTGGG + Exonic
1114874294 14:26696587-26696609 CCCTCTCAATGGTTTGCAGATGG + Intergenic
1114881336 14:26789720-26789742 CCCTCTCCTTGGCTTCCAGATGG - Intergenic
1115336006 14:32244918-32244940 TAATCTGGATGGTTTTCAGATGG - Intergenic
1117265608 14:54083370-54083392 TCATATGCATGGGTTCCAGGTGG - Intergenic
1117799966 14:59433190-59433212 TCAGCAACATGGTTTCCTGATGG + Intronic
1124686052 15:31782852-31782874 ATGTCTCCATGGTTTCCACAGGG - Intronic
1125368843 15:38948256-38948278 TCATATTCATGGGTTCCAGTAGG + Intergenic
1125710195 15:41778960-41778982 TCTTACCCATTGTTTCCAGAAGG - Intronic
1126585952 15:50287576-50287598 TGCTCTCCTTGGTTTGCAGATGG - Intronic
1126905396 15:53359440-53359462 CCCTCTTCCTGGTTTCCAGAAGG + Intergenic
1127603094 15:60558169-60558191 ACATCTCCATGGTCTCTGGATGG + Intronic
1127766531 15:62190497-62190519 TCATCACCATTGCTTCTAGAAGG + Intergenic
1130065355 15:80598395-80598417 TACTCTCCCTGGTTTACAGATGG + Intergenic
1132085303 15:98903646-98903668 ACATCTGAATGGTTTCCAGTGGG - Intronic
1134314688 16:13107780-13107802 TCATCCCCATTGTTTCCAAATGG - Intronic
1134853626 16:17501878-17501900 TCCTCTCCCTGGTTTCCCTAAGG + Intergenic
1136289890 16:29265218-29265240 GGATCTCCATGGTTTTAAGAGGG - Intergenic
1138681451 16:58686217-58686239 CCATCTTCATAGTTTTCAGATGG + Intergenic
1140681869 16:77393128-77393150 TCACCTCCATGGTGACCAGATGG - Intronic
1141164778 16:81653153-81653175 TCAACTCCAGTGTTCCCAGAGGG - Intronic
1142095776 16:88238694-88238716 GGATCTCCATGGTTTTAAGAGGG - Intergenic
1142979859 17:3665271-3665293 ACATCTCCATGTTTTCTAAAAGG - Intronic
1144233311 17:13231061-13231083 TCATCTGTATGAATTCCAGAAGG - Intergenic
1144421852 17:15106091-15106113 TTCTCTCCCTAGTTTCCAGATGG + Intergenic
1144791528 17:17862250-17862272 TCAACTCCCTGAATTCCAGATGG + Intronic
1146931880 17:36783409-36783431 GCTTCTCCATGCTTTACAGATGG + Intergenic
1147978387 17:44260597-44260619 TCATCTGCAGGGGGTCCAGAAGG + Intronic
1148754116 17:49963571-49963593 TCAACTCCAGGGGGTCCAGAGGG + Intergenic
1148796126 17:50197733-50197755 TCATCTCCATTCTTTCCAGGGGG + Exonic
1149129497 17:53280907-53280929 ATACCTCCAGGGTTTCCAGATGG - Intergenic
1150265906 17:63832301-63832323 TCATCTCCTGGGATGCCAGAGGG - Exonic
1152778236 17:82215201-82215223 GCCTCTCCATGGCTTGCAGACGG - Intergenic
1153545993 18:6205304-6205326 TCTTCTCCAGAGCTTCCAGAAGG + Intronic
1154220331 18:12447388-12447410 TCAGCTACATAGTTTCCACAGGG - Exonic
1154345794 18:13542632-13542654 TCTTCTCCCTGGATTCCTGAGGG - Intronic
1155342586 18:24827688-24827710 ACATCTCAATGGTTTCCATCTGG + Intergenic
1156157703 18:34322694-34322716 GCATCTGCAGGTTTTCCAGAGGG + Intergenic
1156775574 18:40784053-40784075 TCATCTCAACGGTGTCAAGAAGG - Intergenic
1156818257 18:41338826-41338848 TTAACTGCATGGTTTCAAGATGG - Intergenic
1156871037 18:41945235-41945257 TCCTCTTCATAGTCTCCAGAAGG + Intergenic
1158243767 18:55407408-55407430 TGATCTCCTTTGTCTCCAGAAGG - Intronic
1158871573 18:61693241-61693263 TCATTTTCATGGTCTCCAGATGG - Intergenic
1159779682 18:72646446-72646468 TCTTCTGCAAGGTTTCCACATGG - Intergenic
1159886658 18:73914003-73914025 TCATCTCTTTGGCTTCCAGGAGG - Intergenic
1164057618 19:21635041-21635063 GCATCTCCATTATTTGCAGATGG + Intergenic
1164193462 19:22932632-22932654 TCATCATCATGCTTTCCAGCAGG - Intergenic
1165422939 19:35731465-35731487 AAAACTCCCTGGTTTCCAGACGG - Intronic
1166452242 19:42911842-42911864 TCATATCAGTGGATTCCAGAGGG + Intronic
1166659236 19:44635101-44635123 CCCTCTCCATGGCTTGCAGAAGG + Intronic
1168657250 19:58139481-58139503 TCCTCTTCCTGGTTTGCAGATGG + Intronic
925439929 2:3876668-3876690 TCATCTCCCTGGTGGCCAGAGGG - Intergenic
927181698 2:20451082-20451104 TCATCTTTATGTTTTCCAGTTGG - Intergenic
927300027 2:21501556-21501578 TCCTCTCCTTGCTTTGCAGATGG - Intergenic
928245146 2:29620279-29620301 CCTTCTCCCTGGTTTACAGATGG + Intronic
929320147 2:40533231-40533253 TCATCTCCATGGTTTCTGCCAGG - Intronic
930420616 2:51149376-51149398 TCATTTCCATTTTTTTCAGATGG + Intergenic
930426913 2:51224296-51224318 TTCTCTCCGTGGTTTGCAGATGG + Intergenic
934819251 2:97357703-97357725 TCTTCCCCATGGTGTCCACAGGG + Intergenic
934918262 2:98318935-98318957 TCATATCCATGGGTTCCACAGGG - Intergenic
936734902 2:115428612-115428634 TCATCTGAATGGTTTCCTCATGG - Intronic
941106141 2:161355587-161355609 TGATCTCAGAGGTTTCCAGATGG - Intronic
943184639 2:184591864-184591886 TCCTCTTCCTGGTTTGCAGATGG - Intergenic
944345604 2:198661505-198661527 ATATCTCCATGGTCTCCAGAAGG + Intergenic
945150723 2:206787756-206787778 TTGTCTCCCTGGTTTCCACAGGG - Intronic
946935119 2:224712133-224712155 TCATCTCCATGGGTCACAAAGGG + Intergenic
948081239 2:235207075-235207097 TCATCTCCATGGTGGCCCCAGGG - Intergenic
1169282964 20:4282720-4282742 TCTTTTCCATGGTTACAAGATGG + Intergenic
1170040662 20:12036176-12036198 TCCTCTCTATGCTTCCCAGAAGG + Intergenic
1174688293 20:52476768-52476790 TGATCCCCATGCTTTACAGATGG - Intergenic
1175456252 20:59117231-59117253 TCATCTCCGGGGGCTCCAGATGG + Intergenic
1175968548 20:62672376-62672398 TCATATCCACGGATTCCACAGGG - Intronic
1177656410 21:24022087-24022109 TCCTCTTCCTGGTTTTCAGAGGG - Intergenic
1178913474 21:36694357-36694379 ACATCCCCATGGCTTCCAGAGGG - Intergenic
1179521191 21:41946324-41946346 TAATCTCCAGTGTTACCAGATGG + Intronic
1179929471 21:44557857-44557879 TCATCTCCATGCTGGCCAGCCGG - Exonic
1180864140 22:19106158-19106180 TCACCTCCATGCTTTACAGATGG - Intronic
1181532882 22:23527051-23527073 TTATCTCCATGGTGCCCAGATGG - Intergenic
1181832906 22:25577099-25577121 TCATCTCCATGCCTGCCAGTTGG + Intronic
1182818593 22:33191700-33191722 TAATCTACAGGGTTTCTAGAAGG + Intronic
1182990037 22:34758941-34758963 TCTTCTCCATGGTTTTCTGTTGG + Intergenic
1184263745 22:43335130-43335152 TCACATCCTTGGTTTACAGATGG - Intronic
1184331935 22:43832983-43833005 ACATCGACATGGTTTCCAGCTGG + Intronic
1184801686 22:46764575-46764597 TCACATCCATAGTTTCCAGATGG - Intronic
1185004926 22:48270178-48270200 GCCTCTCCATGGTTTGTAGAAGG + Intergenic
950106511 3:10392290-10392312 TCATCTTTATGTTTTGCAGAGGG + Intronic
952650314 3:35718860-35718882 TCATCTTCCTGGATTCCAGTAGG + Intronic
952650330 3:35719075-35719097 TCATCTTCCTGGATTCCAGTAGG + Intronic
952871072 3:37901962-37901984 TCATCTTCGTGGTTGCGAGATGG + Intronic
953015461 3:39071453-39071475 TCATCTCCATGGTTTCCAGAAGG + Intronic
953815733 3:46154668-46154690 CCTCTTCCATGGTTTCCAGAAGG - Intergenic
956745953 3:72311137-72311159 CCATCTCCACAGTTTGCAGATGG + Intergenic
958790668 3:98647385-98647407 GCATCTCCTTGGCTTGCAGAGGG + Intergenic
959594619 3:108115504-108115526 TTATCTCCATAGTTTCCATAGGG - Intergenic
960463054 3:117960370-117960392 TGCTCTCCTTGGTTTGCAGATGG - Intergenic
960504287 3:118473866-118473888 TTCTCTCCTTGGTTTACAGATGG + Intergenic
962025586 3:131543925-131543947 TCATCTTCCAGCTTTCCAGATGG - Intronic
962153752 3:132921962-132921984 TCATCTCCATGCTTTCTGTAAGG + Intergenic
962350317 3:134651347-134651369 TCATCCCCACGGTCTCCGGAGGG + Intronic
962352196 3:134664212-134664234 TCAACTCCCTGGTTCCTAGACGG - Intronic
963125470 3:141811915-141811937 GCATCTCCAGGGGCTCCAGATGG + Intronic
963916335 3:150861991-150862013 ACATCTCTATGGTTTCCACCTGG + Intergenic
964312588 3:155410579-155410601 GCCTCTCCCTGGTTTGCAGATGG - Intronic
967393501 3:188980696-188980718 TTTTCTTCATGGTTTCAAGATGG + Intronic
967815553 3:193795550-193795572 TCATCTCCAGGGCTTCGTGAAGG - Intergenic
969854984 4:9991774-9991796 TTCTCTCCATGGCTTGCAGATGG - Intronic
969916857 4:10499777-10499799 CCCTCTCCTTGGTTTGCAGATGG + Intronic
970922586 4:21412313-21412335 TCCTTTCCATGGATTCCACATGG + Intronic
971267905 4:25111048-25111070 TCATCTGCTTGGTTACCAGATGG + Intergenic
973011598 4:45082343-45082365 ACATCTCCATGGTTACAAGAGGG - Intergenic
976123877 4:81812434-81812456 TCATAGCCATGGTTTCCTCAGGG + Intronic
976366945 4:84243329-84243351 TCTTCTCCTTCGTTTCCAGCTGG - Intergenic
976392056 4:84516061-84516083 TTATCTCCTTGGCTTGCAGATGG - Intergenic
982499773 4:156138503-156138525 CCATCTCAATTATTTCCAGAGGG + Intergenic
982988007 4:162234497-162234519 TAAAACCCATGGTTTCCAGAGGG + Intergenic
984406339 4:179336399-179336421 TAATCTCCATGGTTTGTTGATGG - Intergenic
984875704 4:184365643-184365665 TGATCTTCTTGGCTTCCAGAAGG - Intergenic
986206056 5:5626296-5626318 TCCTCTTCCTGGTTTGCAGATGG - Intergenic
986576189 5:9215172-9215194 TCATCTCCATTGTTAGCAGATGG - Intronic
989128344 5:38078897-38078919 TTATCTCCATTTTTTTCAGATGG + Intergenic
990821194 5:59842092-59842114 TGATCACCCTGGTTTCCAGGTGG + Intronic
991029916 5:62071993-62072015 TCATCTCCCTGGTTTTCACAGGG + Intergenic
991776417 5:70089866-70089888 TGATCTCCTTGGTTTCCATGTGG - Intergenic
991855704 5:70965313-70965335 TGATCTCCTTGGTTTCCATGTGG - Intergenic
991869719 5:71098091-71098113 TGATCTCCTTGGTTTCCATGTGG - Intergenic
992568006 5:78021752-78021774 TCATCCTCATGGTTGCCACATGG + Intronic
992951279 5:81860382-81860404 TCATCTCACTGGTTTTCAGTGGG + Intergenic
993374020 5:87127911-87127933 TCATCTTCATGCTTTCCCCAAGG + Intergenic
994067486 5:95559366-95559388 TCCTATCCATGGGTTCCACAGGG + Intronic
994977393 5:106827844-106827866 TCATCTCTGTGATTTCTAGAGGG - Intergenic
996835470 5:127787204-127787226 ACATCTCCATGGTACCCAAAAGG + Intergenic
997411534 5:133694791-133694813 TCCTCTTCCTGGTTTGCAGATGG + Intergenic
998471321 5:142386217-142386239 TCATCCCCATGGTTTCAGGGTGG - Intergenic
998510046 5:142705521-142705543 TTATATCCATGGATTCCACAGGG - Intergenic
999117089 5:149173633-149173655 TCATCTGCCTGGCTTCCAGGTGG + Intronic
999117258 5:149174719-149174741 TCATCTCCTCTCTTTCCAGAGGG - Intronic
999157999 5:149472187-149472209 TCAGCTCCCTGCTTTCCAGGAGG - Intergenic
1000731320 5:164837399-164837421 ACATCTGCTTTGTTTCCAGAGGG - Intergenic
1001192003 5:169639983-169640005 CTATCTCCATGGTTTGCAGATGG + Intronic
1001242964 5:170084034-170084056 TCCACCCCAAGGTTTCCAGATGG - Intergenic
1001815573 5:174666435-174666457 TCTTCTCCAGAGCTTCCAGAAGG - Intergenic
1002792922 6:448834-448856 ACCTCTCCTTGGTTTGCAGATGG - Intergenic
1002894046 6:1364699-1364721 TCCTCTCCTTGGCTTGCAGATGG + Intergenic
1005431717 6:25764417-25764439 TCATTTCCATGGCTTTCAGAAGG - Intronic
1006585546 6:35108347-35108369 TCCTCTTCATGGCTTGCAGATGG - Intergenic
1007525768 6:42491445-42491467 TCATCTTCCTGGCTTACAGATGG + Intergenic
1008343513 6:50397197-50397219 TAATCTCCATGATTTCTTGATGG + Intergenic
1009527109 6:64761352-64761374 TCTTATCCATTGTTTACAGATGG - Intronic
1010330273 6:74615545-74615567 TCATATCCATGTTTTGGAGAGGG + Intergenic
1012054894 6:94393823-94393845 TCACCTCCAAGGGTTCCTGATGG - Intergenic
1012521748 6:100129147-100129169 TCATATCCTTGGTATCCACAAGG + Intergenic
1015671658 6:135697780-135697802 TCATCTCCCATGCTTCCAGAAGG - Intergenic
1015821039 6:137260531-137260553 TCATCCCCTTCGTTTCCATAGGG + Intergenic
1017998557 6:159557225-159557247 ACATCTCCAAAGTGTCCAGATGG - Intergenic
1018266379 6:162028882-162028904 TCTTCTCTTTGGTTTCCACATGG - Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1020240585 7:6391491-6391513 CCCTCTGCAGGGTTTCCAGAAGG - Intronic
1020807895 7:12813311-12813333 TTATCTGCATGGAGTCCAGATGG + Intergenic
1022130738 7:27402226-27402248 TTCTCTCCTTGGTTTGCAGATGG + Intergenic
1022193501 7:28040976-28040998 TAATCTCTGTGGTTTCTAGATGG - Intronic
1023507681 7:40917737-40917759 CCCTCTTCATGGTTTGCAGATGG + Intergenic
1023559551 7:41459683-41459705 TCATCTCCATAGCTTCAGGAAGG + Intergenic
1025132160 7:56380753-56380775 TCCTATACATGGATTCCAGAGGG - Intergenic
1027474747 7:78615377-78615399 TCATCTCCAGGGAAACCAGATGG + Intronic
1027844935 7:83360956-83360978 TCATCTTCCTGGTTTGCAGACGG + Intergenic
1027882807 7:83863432-83863454 TCCTCTTCCTGGTTTGCAGAAGG - Intergenic
1027986172 7:85293835-85293857 TCTTCTCTATAGATTCCAGAGGG - Intergenic
1028196456 7:87913084-87913106 TAATCTCCATGGCATCCAGATGG + Intergenic
1028389226 7:90295583-90295605 TCCCTTCCATGGTTGCCAGAAGG + Intronic
1030932636 7:115544071-115544093 TCATCACCATTCTTTGCAGAAGG + Intergenic
1033034013 7:137854147-137854169 TCATTTTCATGGTTGCAAGACGG - Intergenic
1033457529 7:141516312-141516334 TCAGTTCCATGGCTTGCAGAGGG - Intergenic
1034130094 7:148707859-148707881 TCCAATTCATGGTTTCCAGAGGG + Intronic
1034486485 7:151367767-151367789 TCATTCCCTTGGTCTCCAGAGGG - Intronic
1035235232 7:157493520-157493542 TCTCCTCCCTGGTTTACAGACGG - Intergenic
1036107814 8:5860493-5860515 ACAGCTTCATGGTTTCCAAAAGG + Intergenic
1037858857 8:22390602-22390624 ACAACTCCATGTTTTCTAGAAGG + Intronic
1039808927 8:41027500-41027522 TCAGTGACATGGTTTCCAGATGG - Intergenic
1041412708 8:57574352-57574374 TCATCTTTAGGGTGTCCAGATGG + Intergenic
1042945914 8:74154326-74154348 CCATTTACATGGTCTCCAGATGG - Intergenic
1043973807 8:86563168-86563190 TCATCACCATGGATGCCTGAAGG - Intronic
1044742505 8:95342310-95342332 TCTTCACCATCCTTTCCAGAAGG + Intergenic
1045640704 8:104247330-104247352 TCTTCTCCTTGGCTTGCAGATGG + Intronic
1046232822 8:111380224-111380246 TCATCTCCAGGCTTCCCACAGGG + Intergenic
1047624685 8:126644478-126644500 TCATCTTCCTGGCTTGCAGACGG - Intergenic
1048267795 8:133003004-133003026 ACAACTCCATGTTTTCCAAAAGG + Intronic
1048942508 8:139413932-139413954 TCATCCACGTGGTCTCCAGAGGG + Intergenic
1050524310 9:6532111-6532133 TCATCCGCATGGTCTCAAGAAGG - Intergenic
1051406415 9:16742445-16742467 TCATTTCCCTGCTCTCCAGAGGG - Intronic
1051612475 9:18974798-18974820 TCACCACCATGGTTGCCAAATGG - Intronic
1052184630 9:25577251-25577273 CCATCTTCAGGGTCTCCAGATGG + Intergenic
1053406026 9:37876899-37876921 CCCTCTCCCTGGTTTGCAGAGGG - Intronic
1055915984 9:81400751-81400773 TCCTATCCCTGGTTTGCAGATGG + Intergenic
1057061334 9:92006113-92006135 ACAACTCCATGTTTTCCAAAAGG - Intergenic
1057163300 9:92906584-92906606 TCATTTCCATACTTTCTAGATGG + Intergenic
1057780706 9:98047762-98047784 TCATTTCCATGCTTTCTAGGTGG - Intergenic
1057933626 9:99218173-99218195 GCATGTACATGGCTTCCAGAGGG + Exonic
1061970027 9:134039912-134039934 CCATCACCCTGGTTTCCAGGTGG + Intronic
1062498536 9:136842774-136842796 CCATCTCCGTGGGCTCCAGAAGG + Intronic
1185713329 X:2321605-2321627 TCCTCTTCTTGGTTTACAGATGG - Intronic
1185789045 X:2914658-2914680 TCCTCTCCAGGGTTTCTTGAAGG + Intronic
1186556457 X:10565222-10565244 TCCTCTACATGGTTTAAAGATGG + Intronic
1186623515 X:11266668-11266690 TGATCTCCATGCATTCCACATGG + Intronic
1186885141 X:13905533-13905555 TCATCTTCATGTTGTACAGATGG - Intronic
1186988683 X:15044345-15044367 GCCTCTCCAAAGTTTCCAGAAGG + Intergenic
1187289934 X:17943247-17943269 TCAGTCCCATGGTTTCCATATGG + Intergenic
1188245125 X:27829926-27829948 ACATCACCCTCGTTTCCAGAAGG - Intergenic
1188252404 X:27913632-27913654 TCTACTCCATGTCTTCCAGAAGG - Intergenic
1189845384 X:45131742-45131764 CCATCTCCCTGGGTTGCAGAGGG - Intergenic
1192370335 X:70507640-70507662 TATTATCCATGTTTTCCAGATGG + Intergenic
1192848327 X:74927699-74927721 CCATCTCCTTGGCTTGCAGATGG - Intergenic
1193340691 X:80345819-80345841 TAATCTGCAGGGTTTCCATAAGG + Intronic
1193499041 X:82250256-82250278 TCCTCTTCCTGGCTTCCAGATGG - Intergenic
1195612014 X:106878234-106878256 TCATCTCTGTGGTTTCCCTAGGG + Intronic
1196263999 X:113619917-113619939 TCCTCTTCCTGGTTTGCAGATGG - Intergenic
1196674560 X:118405673-118405695 CCATATCCATGGGTTCCACATGG + Intronic
1197731712 X:129816268-129816290 TCATATCCATGGGTTCCACAGGG + Intronic
1198415047 X:136411495-136411517 TCAAATCCATGGTTTCCACATGG + Intronic
1201285936 Y:12378709-12378731 TCCTCTCCATGGTTTCCTGAAGG - Intergenic
1202336221 Y:23813529-23813551 TCATCACTGTGGTTTGCAGAAGG + Intergenic
1202534545 Y:25856538-25856560 TCATCACTGTGGTTTGCAGAAGG - Intergenic