ID: 953019593

View in Genome Browser
Species Human (GRCh38)
Location 3:39105039-39105061
Sequence GCTGCTCTCCATCATGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 136}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953019586_953019593 5 Left 953019586 3:39105011-39105033 CCTCCCCACTCCCCAGTATTGCA 0: 1
1: 0
2: 0
3: 23
4: 304
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019583_953019593 17 Left 953019583 3:39104999-39105021 CCTGCCTACTTCCCTCCCCACTC 0: 1
1: 1
2: 8
3: 123
4: 1190
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019590_953019593 -5 Left 953019590 3:39105021-39105043 CCCCAGTATTGCATGTCAGCTGC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019585_953019593 6 Left 953019585 3:39105010-39105032 CCCTCCCCACTCCCCAGTATTGC 0: 1
1: 0
2: 3
3: 42
4: 434
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019592_953019593 -7 Left 953019592 3:39105023-39105045 CCAGTATTGCATGTCAGCTGCTC 0: 1
1: 0
2: 1
3: 9
4: 87
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019582_953019593 29 Left 953019582 3:39104987-39105009 CCACGTCAGGTGCCTGCCTACTT 0: 1
1: 0
2: 1
3: 1
4: 83
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019587_953019593 2 Left 953019587 3:39105014-39105036 CCCCACTCCCCAGTATTGCATGT 0: 1
1: 0
2: 1
3: 16
4: 148
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019589_953019593 0 Left 953019589 3:39105016-39105038 CCACTCCCCAGTATTGCATGTCA 0: 1
1: 0
2: 1
3: 10
4: 162
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019584_953019593 13 Left 953019584 3:39105003-39105025 CCTACTTCCCTCCCCACTCCCCA 0: 1
1: 3
2: 28
3: 259
4: 2824
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019591_953019593 -6 Left 953019591 3:39105022-39105044 CCCAGTATTGCATGTCAGCTGCT 0: 1
1: 0
2: 0
3: 4
4: 115
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
953019588_953019593 1 Left 953019588 3:39105015-39105037 CCCACTCCCCAGTATTGCATGTC 0: 1
1: 0
2: 0
3: 12
4: 86
Right 953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG 0: 1
1: 0
2: 2
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953019593 Original CRISPR GCTGCTCTCCATCATGAATG AGG Intronic
902528030 1:17071826-17071848 GCAGCTGACCAGCATGAATGTGG + Intronic
902896614 1:19484595-19484617 GGAGCTCTCCATCAGGGATGGGG - Intronic
902983571 1:20142129-20142151 CCTGCTCCCCAGCCTGAATGAGG - Intronic
903548734 1:24143052-24143074 GCTGCTGACCATCTTGACTGTGG - Exonic
905302705 1:36996687-36996709 GCTGTTCCCCACCAGGAATGAGG - Intronic
907226063 1:52947402-52947424 GCTGCTCACTGTCATAAATGAGG + Intronic
908458380 1:64326212-64326234 GCTGCTCCACACCAGGAATGTGG + Intergenic
908689030 1:66756399-66756421 GTTATTCTCCTTCATGAATGAGG + Intronic
911733885 1:101316391-101316413 GCTGCTGTCCATCATACAGGTGG - Intergenic
912696698 1:111847601-111847623 GCTGCTTGCCCTCAGGAATGGGG - Intronic
913148170 1:116012869-116012891 GCTGCCCAGCATCATGAAAGAGG - Intronic
917988379 1:180346457-180346479 TCTGCCCTCCATCATGAAAGTGG - Intronic
920698330 1:208198723-208198745 GCAGCTCTCCATCAGGCAAGTGG + Intronic
921123241 1:212154810-212154832 GCTACCCTCCATCATGCAGGTGG + Intergenic
922778762 1:228233001-228233023 GCTGGTCTTCATCCTGATTGTGG + Intronic
1064223819 10:13464674-13464696 GTTCCTCTTCATCTTGAATGTGG - Intronic
1069842850 10:71350682-71350704 CCTGCTCCCCATGATGACTGAGG + Intronic
1069919863 10:71810028-71810050 CCTGCTCTCCAACATCACTGGGG + Exonic
1070120168 10:73568335-73568357 GAAGCTCTCCATCCTGGATGAGG + Intronic
1070662618 10:78318368-78318390 GCTGCTCTACAGCATGATTGGGG - Intergenic
1075089674 10:119436695-119436717 GGTCCTGACCATCATGAATGGGG + Exonic
1077079778 11:720069-720091 GCTCTTGTCCATGATGAATGTGG - Exonic
1083693829 11:64429439-64429461 TCTGCTCTTCATCAAGAAGGAGG - Intergenic
1083714324 11:64567133-64567155 CAGGCTCTCCATCCTGAATGTGG + Intronic
1083760967 11:64817498-64817520 GCGGCTCTCCAGGATGACTGTGG + Intergenic
1084567985 11:69942447-69942469 CCTGACCTCCAGCATGAATGCGG - Intergenic
1086557009 11:88122427-88122449 GCTGCTGTTTTTCATGAATGGGG - Intronic
1086802067 11:91188423-91188445 ATTGCTCTCCATGATAAATGAGG + Intergenic
1088764959 11:112965738-112965760 GCTGCTCTCCAGACTGAAAGTGG + Intronic
1088851687 11:113708487-113708509 GCTGGTTTCCATGATGATTGTGG - Intergenic
1089665425 11:120014850-120014872 ACTGCTCTCCATCTTCACTGAGG - Intergenic
1089678428 11:120105982-120106004 CCTGCTCTCCACCATGCATCAGG + Intergenic
1089770270 11:120797418-120797440 GCTGCTCTCCTTCATTCATCTGG + Intronic
1090363714 11:126189857-126189879 TCGCCTCTCCAGCATGAATGAGG - Intergenic
1090652788 11:128822296-128822318 ACTGCTCTCCATGAAGAATGTGG - Intergenic
1092084116 12:5741649-5741671 GCTGCTCTCCATCAGTATGGTGG - Intronic
1095626368 12:44319242-44319264 CCTGCTCTCCATCCTGAGTCTGG + Intronic
1101683913 12:106997810-106997832 TCTGCTGCCCATCATGAGTGGGG + Intronic
1104780751 12:131418536-131418558 GATGCTCAACATCATGAATCAGG - Intergenic
1105356149 13:19661817-19661839 CCTTCTCTGCAGCATGAATGAGG - Exonic
1106306550 13:28516231-28516253 ACTGCACTCCAGCATGGATGTGG + Intergenic
1110719290 13:78743677-78743699 CCTGTCCTCCCTCATGAATGTGG + Intergenic
1110751875 13:79124080-79124102 GCTTCTCTCCATCTTGAAATGGG + Intergenic
1112302019 13:98239559-98239581 ACTGATCTCCAGCATGAGTGGGG + Intronic
1113709777 13:112455554-112455576 GCTGGTCTCCATCACGCATTAGG + Intergenic
1115459279 14:33641615-33641637 GATGCTCTCCATCAGGAGAGAGG - Intronic
1116798088 14:49413205-49413227 GCTGCTCCCCACCCTGAGTGAGG - Intergenic
1118495548 14:66305074-66305096 ACTACTCTCCATCATGCTTGGGG - Intergenic
1118737007 14:68708404-68708426 GCTGCTCTCCTTGATGAAGCGGG + Intronic
1121882900 14:97516215-97516237 ACTGCTCTCCATCATGCCTTTGG + Intergenic
1122882938 14:104698143-104698165 TCTGCTCTCCATCTGGAAAGTGG - Intronic
1125727089 15:41873681-41873703 CCTGCTCTCCAGCATCAAAGGGG + Intronic
1128364260 15:66986165-66986187 GGTGCTCTCCAGCATGACTTTGG + Intergenic
1131370469 15:91876811-91876833 TCTGCTGTCCAGCATGGATGTGG + Intronic
1132538661 16:496833-496855 GCGGCTCTCCAGCAAGAAGGTGG + Exonic
1134916002 16:18071578-18071600 GCCTCTCTCCATCGTGCATGCGG + Intergenic
1138668169 16:58590555-58590577 ACTGCACTCCATCCTGGATGAGG + Intronic
1138836956 16:60448990-60449012 CCTGCCCTCCAGCATGAATGTGG - Intergenic
1139801499 16:69526667-69526689 CCTGCTCCACATTATGAATGTGG + Intergenic
1140058348 16:71545433-71545455 GCTGCTCTTCATGAAGAACGAGG + Intronic
1143432524 17:6897684-6897706 GCTGCTCACCCCCATGAATCAGG - Intronic
1144018027 17:11215191-11215213 TCTGCTCTCCATTATGAACCAGG - Intergenic
1150697688 17:67419866-67419888 GCTGCACTCCAGCCTGAGTGAGG + Intronic
1155479313 18:26268280-26268302 GCTGATCTCCAACATGTATGAGG - Intronic
1158231537 18:55261230-55261252 GCTGCACTCAATTATGGATGTGG - Intronic
1160336727 18:78048358-78048380 ACCCCTCTCCACCATGAATGTGG + Intergenic
1164552734 19:29225248-29225270 GCAGCCCACCATCATGAATTGGG + Intergenic
1166602585 19:44110974-44110996 TATGCTTTCCATCATGAATCGGG + Intergenic
929663341 2:43812253-43812275 GCTGATCTCCAGCCTTAATGGGG + Intergenic
933578957 2:84103432-84103454 TCTTCTCCCCATCATGAAGGTGG + Intergenic
935652759 2:105396434-105396456 GCTGCTCTCCATAATGTGAGTGG - Intronic
937819062 2:126287484-126287506 CCTTATCTCCATCATGGATGAGG - Intergenic
937914946 2:127094400-127094422 GCTGGTCTCAATCCTGAAGGGGG - Intronic
937983521 2:127628396-127628418 GCTGCTCTCCACGATGCATGAGG + Exonic
942865447 2:180668160-180668182 GTTGCTTTCTAACATGAATGTGG - Intergenic
944121565 2:196246165-196246187 GCTGCTCTCCTAGATGAATGAGG + Intronic
945905705 2:215590450-215590472 AGTGTTCTCCATCATGAATATGG + Intergenic
946694652 2:222342479-222342501 TTTGCTTTCCATCATGATTGTGG - Intergenic
947458798 2:230283809-230283831 GCTGCTCTGCAGCCTGAAGGAGG + Intronic
947469041 2:230382977-230382999 GCTGCTCTGCAGCCTGAAGGAGG + Intronic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1169204068 20:3730369-3730391 GCTCCTCTCCAGCATGGTTGTGG - Intergenic
1170283415 20:14677624-14677646 GCTGCTCTTCGTCAGGACTGAGG - Intronic
1175134047 20:56809727-56809749 GCTGATCTCCAGCCTGAATCAGG - Intergenic
1178363680 21:31970541-31970563 GCTGCTCTCCATCATGAGTATGG - Intronic
1178620207 21:34167621-34167643 TCTGCACCCCATAATGAATGTGG + Intergenic
1181394218 22:22607477-22607499 ACTGCTCTCCACAATGCATGTGG - Intergenic
953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG + Intronic
953488275 3:43323977-43323999 GCTGCTCTGTATCTTGATTGTGG + Intronic
954145613 3:48632915-48632937 CCTGCCCTCCATGATGGATGTGG + Intronic
954679157 3:52332272-52332294 GCTGCTCTACAACTTGTATGTGG + Exonic
961032484 3:123618601-123618623 GCTTCTCTTCACCATGAATAGGG - Intronic
962270940 3:133977729-133977751 CCTGATATCCATCATGAGTGAGG + Intronic
964441771 3:156718695-156718717 GCCTCTTTCCATCAAGAATGGGG - Intergenic
966243657 3:177782038-177782060 TCTGATCTCCCTCATGACTGGGG + Intergenic
967500371 3:190190638-190190660 GTTGCCCTCTAACATGAATGGGG + Intergenic
969306799 4:6330474-6330496 GCTGCCCTCCATCATGTGGGGGG + Intronic
976222845 4:82771918-82771940 GCTGCTTTTGATCATGAGTGTGG - Intronic
976986398 4:91304598-91304620 GCTGCCCTCCATTATAAAAGAGG - Intronic
977890211 4:102301230-102301252 ACTGCTCTCCAGCATTGATGTGG + Intronic
978135827 4:105258036-105258058 GCTGCTTTTCATAATAAATGTGG + Intronic
979085287 4:116401539-116401561 GCTGCTCTCCTTCATTAACAAGG + Intergenic
986264635 5:6181337-6181359 CCTCCTCTCCATCCTGAAGGAGG + Intergenic
987086940 5:14479096-14479118 GCTGATCTACATCCTGAATCTGG + Intronic
987179649 5:15354195-15354217 GCTGCTTTCCATAATGTATGCGG - Intergenic
987613833 5:20246688-20246710 GCTCTTAACCATCATGAATGTGG - Intronic
992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG + Intronic
996873971 5:128221419-128221441 GCTGTTCTGCATCTTGATTGTGG + Intergenic
1003468122 6:6401007-6401029 GATGCTGTACATCATGAATAGGG + Intergenic
1004481013 6:16019317-16019339 ACTGATCACCAGCATGAATGGGG + Intergenic
1010947796 6:81998540-81998562 GTTGCTCTCCCTCATGTATTGGG - Intergenic
1011205238 6:84886996-84887018 GCTGTTCTCAATCATGAAAAAGG + Intergenic
1014962480 6:127704249-127704271 ACTGCTCTGAATCATGTATGAGG + Intergenic
1017428001 6:154342457-154342479 ACTGCTCTCCATCCTGAAAAGGG - Intronic
1018681926 6:166271754-166271776 GCTGCTATCCTTGATGGATGGGG - Intergenic
1024922917 7:54578762-54578784 GATTCTCTCCATCATGGAGGGGG - Intergenic
1026356239 7:69560068-69560090 GCTGCTCACCATCATTAGGGAGG + Intergenic
1030587259 7:111435883-111435905 GCTGCTATCCTTGATGAATGGGG - Intronic
1030897089 7:115074016-115074038 TCTGATCTCCTTCATTAATGAGG - Intergenic
1031431774 7:121679897-121679919 TCTGCTTTACATCATGAATTAGG - Intergenic
1031450372 7:121909901-121909923 GCTGCTTTCCATTATGAGTCTGG + Intronic
1033662468 7:143411786-143411808 ACTGCTCTGCATCTTGACTGAGG - Intergenic
1035120453 7:156562315-156562337 GCTGCTCACCCTCATGGCTGTGG - Intergenic
1035310810 7:157967395-157967417 GCTGCACTCCTTTCTGAATGCGG + Intronic
1037441236 8:18918343-18918365 CCTTCTCTCCATCCTGACTGAGG + Intronic
1037593361 8:20332132-20332154 GGTGGTCTCCATCAAGAATTTGG + Intergenic
1040068497 8:43169365-43169387 GCTGCTCTCTATTAGGAATACGG - Intronic
1041031737 8:53743629-53743651 GCTGGTCTTCATGATGCATGTGG + Exonic
1046602788 8:116337230-116337252 TCTTCTCTCCATTATAAATGTGG - Intergenic
1049287549 8:141783991-141784013 GCAGCCCACCGTCATGAATGAGG + Intergenic
1049765683 8:144354266-144354288 GCTGCTCTTCATCATCAGCGTGG - Exonic
1051137563 9:13939741-13939763 CCTGTTCTCCAGCATAAATGAGG - Intergenic
1051462787 9:17341952-17341974 GCTGCTAACCAAGATGAATGTGG - Intronic
1052466344 9:28835077-28835099 CCTGCTCTCCATGAGGAAGGAGG + Intergenic
1053260726 9:36661143-36661165 GCTGGTCTTCATCGTGATTGTGG + Intronic
1056328959 9:85505851-85505873 GCTCCTCTCCATCATGGCTGAGG + Intergenic
1059030370 9:110687156-110687178 GCTCCTCACCATCCTGAGTGTGG + Exonic
1062058170 9:134479838-134479860 GCTCTTCCCCATCTTGAATGTGG + Intergenic
1062575447 9:137205183-137205205 GCTTCTCTCCATCCTGGAAGAGG + Exonic
1187946565 X:24431883-24431905 GGATCTGTCCATCATGAATGAGG - Intergenic
1189588370 X:42485182-42485204 GCTGCTCTCTACCATGAACTGGG - Intergenic
1190440484 X:50470621-50470643 GCTGCTCTCCATCCTGAGGCGGG + Exonic
1190758906 X:53423539-53423561 TCTGCTCTCTATCATTAATAAGG + Intronic
1194195081 X:90882793-90882815 GCTCCTCTGTATCATGATTGTGG + Intergenic
1194366318 X:93018674-93018696 GCTCCTCACTATCATGAATATGG - Intergenic
1195006537 X:100690840-100690862 GCTGCTGTCCCTTAAGAATGAGG - Intronic
1197972670 X:132131528-132131550 GCAGATCTCCATGATAAATGAGG - Intergenic
1199608384 X:149594136-149594158 GCTGGTCTCCATCTTGAATAAGG - Exonic
1199630736 X:149775224-149775246 GCTGGTCTCCATCTTGAATAAGG + Exonic
1199802804 X:151268234-151268256 CTTGCTCTCCATCCTGACTGAGG - Intergenic
1200674544 Y:6134936-6134958 GCTCCTCACCATCATGAATATGG - Intergenic
1201099262 Y:10659018-10659040 GCTGCACTCCAGCATGGGTGAGG - Intergenic