ID: 953022287

View in Genome Browser
Species Human (GRCh38)
Location 3:39122490-39122512
Sequence TGGAACTCTTTGGGGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953022287_953022293 10 Left 953022287 3:39122490-39122512 CCAGCTTTCCCCAAAGAGTTCCA 0: 1
1: 0
2: 3
3: 27
4: 216
Right 953022293 3:39122523-39122545 AAACTAAAAAAGACGAGCTCAGG 0: 1
1: 0
2: 1
3: 22
4: 274
953022287_953022294 11 Left 953022287 3:39122490-39122512 CCAGCTTTCCCCAAAGAGTTCCA 0: 1
1: 0
2: 3
3: 27
4: 216
Right 953022294 3:39122524-39122546 AACTAAAAAAGACGAGCTCAGGG 0: 1
1: 0
2: 2
3: 35
4: 464
953022287_953022295 21 Left 953022287 3:39122490-39122512 CCAGCTTTCCCCAAAGAGTTCCA 0: 1
1: 0
2: 3
3: 27
4: 216
Right 953022295 3:39122534-39122556 GACGAGCTCAGGGTCACCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953022287 Original CRISPR TGGAACTCTTTGGGGAAAGC TGG (reversed) Intronic
900996775 1:6127146-6127168 AGGAGCTCTTCGGGGACAGCTGG + Intronic
904833681 1:33321266-33321288 TGCAACCTTTTGGGGGAAGCTGG + Intergenic
906175572 1:43768839-43768861 TGGAACTGTTTGAACAAAGCTGG - Intronic
906560128 1:46750358-46750380 TGGAAGTCTCTGGGGAACCCAGG - Intergenic
906633789 1:47394267-47394289 AGGAAGTCTCTGGGGAAAGGAGG - Intergenic
909599494 1:77447089-77447111 TTTCAGTCTTTGGGGAAAGCTGG - Intronic
910352967 1:86320847-86320869 TGGAACTCTCTGCAGAAAGGAGG - Intergenic
910524602 1:88163782-88163804 AGGAACTCGTTGGGGAATGAGGG + Intergenic
910939273 1:92515779-92515801 TGGAAGTCTTTCAGGAAAGCTGG - Intronic
912173764 1:107133093-107133115 TGGGAGTATGTGGGGAAAGCAGG + Intergenic
913205947 1:116538903-116538925 TGTACCTCTTTGGAGATAGCGGG - Intronic
913409330 1:118533649-118533671 TGAATCTCTGTGGGGATAGCTGG - Intergenic
918528854 1:185495189-185495211 AGGAAGTCTTTTGGTAAAGCAGG - Intergenic
919011024 1:191963307-191963329 TGGAACTTATTAGTGAAAGCAGG - Intergenic
922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924287559 1:242503670-242503692 TGGAACTCTTTGGCCAATGATGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924772975 1:247092178-247092200 TTGAGGTCTTTGGGGAGAGCAGG - Intergenic
1063367252 10:5498905-5498927 TGGGACTCTCCGGGGAAACCTGG - Exonic
1063854953 10:10239089-10239111 TTGTACTTTTTGTGGAAAGCTGG - Intergenic
1065010137 10:21413436-21413458 TGGAACGCTGTGGGGAATGGGGG + Intergenic
1065200765 10:23310810-23310832 AGGACCATTTTGGGGAAAGCAGG - Intronic
1067756600 10:49010471-49010493 TGGGACTCTTCTGGGGAAGCAGG - Intergenic
1069819249 10:71217450-71217472 AGGATCTTTTTGGGGGAAGCTGG + Intronic
1069909687 10:71751567-71751589 TGGAACTCTTCAGGGAGGGCAGG + Intronic
1072673462 10:97448454-97448476 TGGAAATATTTGGGGGCAGCTGG + Intronic
1074124282 10:110515939-110515961 TTGATCACTTTGGGGCAAGCAGG - Intergenic
1075068300 10:119304231-119304253 TGGAACCTTGAGGGGAAAGCAGG + Intronic
1076100419 10:127773429-127773451 TGGCTCTCTTTGGACAAAGCAGG + Intergenic
1076123936 10:127960002-127960024 TGTAACTCTTTGGGGAAGCTAGG + Intronic
1077998709 11:7475891-7475913 AGGAACTCTCTGGGAACAGCAGG + Intergenic
1080741588 11:35069448-35069470 TGACACTATTTGGGGAAAGAGGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082084238 11:48036074-48036096 TTGAAGTCTTAGGGGAATGCTGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083126573 11:60573706-60573728 TAGAATTCTTTGGTGAAATCAGG - Intergenic
1084315738 11:68344188-68344210 TGGACCTGTTTGGGGCAGGCAGG + Intronic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085709899 11:78819839-78819861 AGGAACTCTTTGGGAACACCTGG + Intronic
1086015890 11:82167098-82167120 TGGACCCTTTTGTGGAAAGCAGG + Intergenic
1086535414 11:87838574-87838596 TTGAGCTCTCTGGAGAAAGCTGG + Intergenic
1087036732 11:93763829-93763851 TGAAGCTTTCTGGGGAAAGCAGG + Intronic
1087863913 11:103199413-103199435 TGGAAATCTTTGGAGAAAACAGG - Exonic
1089495760 11:118908009-118908031 TGGAGCTCTGGTGGGAAAGCAGG + Intronic
1090201519 11:124861258-124861280 TGGAACCCTGTGGGGAAAGGGGG + Intergenic
1091589698 12:1835943-1835965 TGGCACCCTCTGGGGAAAGCAGG + Exonic
1091688651 12:2581187-2581209 GGGGGCTCTTTGGGGAAAGGTGG + Intronic
1093409710 12:18849905-18849927 GGGAAACCTTTGGGGAATGCAGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096228360 12:49883465-49883487 GGGAAGGCTTTGGGAAAAGCAGG + Intronic
1097083898 12:56453582-56453604 GGCACCTCTTTGGGGTAAGCAGG - Exonic
1097118589 12:56716980-56717002 GGGACCTCTTTGGGGGAAGAAGG + Intronic
1102968584 12:117148112-117148134 TGGTAGTCTTTGGGGAGAGGGGG + Intronic
1103053736 12:117802475-117802497 TGGGCATCTTTGGGGAAAGGGGG + Intronic
1104611903 12:130235604-130235626 AAGAACTCTTTGGAGAAAACAGG + Intergenic
1105773235 13:23632697-23632719 TGGGACTCTGTGGGGAGACCTGG - Intronic
1106046419 13:26146158-26146180 TAGATCCCTTTGGGGAAGGCTGG + Intronic
1106120698 13:26858037-26858059 TGGGACCCTCTGGGGAAGGCTGG + Intergenic
1108018911 13:46105267-46105289 TGTAACTCCTTGGGGAAGGTAGG + Intergenic
1108204626 13:48075170-48075192 TAGACATCTTTGGGGAAAGGGGG - Intronic
1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG + Intergenic
1110839813 13:80128956-80128978 TGGAAATCTTAGGGGAAAATGGG + Intergenic
1116204979 14:41853657-41853679 TGGAACTCAGAGGGGAAATCAGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119810875 14:77518229-77518251 TTGAAATCTTTGAGGACAGCAGG - Intronic
1119888880 14:78167654-78167676 TGGAGCTATCTGGGGAATGCTGG + Intergenic
1120706225 14:87748681-87748703 TAAAACTCTTTGGAGAAACCTGG - Intergenic
1121660687 14:95632865-95632887 TGCAAGTCTTTGGGGACATCTGG + Intergenic
1121938224 14:98041116-98041138 TGGTTATCTTTGGGGGAAGCTGG - Intergenic
1125703591 15:41710830-41710852 TGGTACTCTTAGTGGGAAGCTGG - Exonic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1126627615 15:50699955-50699977 TGGAACTCTTTTGAGACAACTGG + Intergenic
1126868126 15:52958229-52958251 TGAGTCTCTTTGTGGAAAGCAGG + Intergenic
1128411497 15:67403524-67403546 TGGAACTTGTTGGGGGAAGTAGG - Intronic
1128689837 15:69715254-69715276 TGGAACTCTTTTTTGAGAGCTGG + Intergenic
1130099991 15:80886075-80886097 CTGAACTCTTGGGGGAAGGCAGG + Intronic
1130650822 15:85761179-85761201 TGCCACTCAGTGGGGAAAGCAGG - Intronic
1131327174 15:91459258-91459280 TGAAACTCATTGGGGAAAGAGGG - Intergenic
1131389098 15:92032725-92032747 TGGCAAAATTTGGGGAAAGCAGG + Intronic
1132752678 16:1466018-1466040 AGGATCTCTTTGGGGAAAGGAGG - Intronic
1132933022 16:2468294-2468316 TGGAACCCTTTGGGCAGAGAAGG + Intergenic
1132972849 16:2697340-2697362 TGGCAGTCTTTGGGAAGAGCTGG + Intronic
1136268381 16:29133824-29133846 AGGAACTCTTAGAGGGAAGCTGG + Intergenic
1136365855 16:29808962-29808984 TGGTAATGTGTGGGGAAAGCGGG + Intronic
1140859855 16:79009180-79009202 TGGAACTGTTTAATGAAAGCAGG + Intronic
1142071692 16:88094161-88094183 AGGAACTCTTAGAGGGAAGCTGG + Intronic
1144638628 17:16925939-16925961 AGGATTTCTTTGGGGACAGCAGG + Intergenic
1144797952 17:17905201-17905223 TGGGAGTCTTTGGTGAAAGGTGG - Intronic
1146256244 17:31392664-31392686 CGCATCTATTTGGGGAAAGCAGG + Intronic
1147640674 17:41997080-41997102 TGGGGCTGTTTGGGGAAGGCTGG - Intronic
1150419456 17:65018976-65018998 GGGAACTATTTTGGGAAAGAAGG + Intronic
1161306518 19:3572226-3572248 TGGAAGTGTTTGGGGAAAGATGG - Intronic
1162758382 19:12874031-12874053 TGGAAGTCCTTGCGGAAATCCGG - Exonic
1165444002 19:35846612-35846634 AGGAAATCTTTGGGGACAGCAGG - Intronic
1165611822 19:37161027-37161049 TAGAATTCTTTGGTAAAAGCTGG - Intronic
1166327867 19:42062299-42062321 TGGATCTCTTTGGGGAGAGAAGG + Intronic
1166357299 19:42234711-42234733 TGGTGCTGTATGGGGAAAGCTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167803749 19:51764400-51764422 AGGTACTTTTTGGAGAAAGCAGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
927210222 2:20634577-20634599 GGGAGCTCTGTGGGGACAGCAGG - Intronic
927861206 2:26561377-26561399 GGGAAGTCTTTGGAGAATGCTGG + Intergenic
928096095 2:28405982-28406004 AGGTACTCTTTGGGGCTAGCAGG + Intronic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
930548643 2:52802735-52802757 TTAAAGTCTCTGGGGAAAGCAGG - Intergenic
930695202 2:54404508-54404530 ACCAACTCTTTGGGGAAGGCAGG - Intergenic
931812396 2:65867468-65867490 TGGAGCTCTTTGGGGAAGAGTGG - Intergenic
932683671 2:73849466-73849488 TGGAATTCTCTGTGGAAAACTGG + Exonic
934084900 2:88501902-88501924 TGGAAATTTATGGGGAAAACAGG + Intergenic
935603775 2:104948944-104948966 TGGAAATCTCTGGGGAGAACAGG + Intergenic
937162422 2:119777225-119777247 TGGAACACTTGGGAGAAAGGTGG - Intronic
937220768 2:120342254-120342276 AGGAACTCCTTGGAGAAGGCAGG - Intergenic
938137259 2:128769723-128769745 TTGGACTCTTTGAGGAATGCAGG + Intergenic
940673855 2:156704861-156704883 TGAACCTCTCTGGGGAGAGCAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942546623 2:177071354-177071376 TGGATTTCTTGGGGGAAGGCAGG - Intergenic
943213573 2:185001169-185001191 TGAAACTCTTTAGGGAGACCTGG - Intergenic
945126092 2:206511605-206511627 TGGAGCTCTGTGTGGCAAGCAGG + Intronic
946415608 2:219538366-219538388 TGTAAATATTTAGGGAAAGCCGG + Exonic
947398541 2:229711051-229711073 TGGGGCTCTCTGGGGAGAGCAGG + Intronic
947560619 2:231147104-231147126 AGGATCTCTTTGGGGCAAGCTGG - Intronic
1168755805 20:316805-316827 AGGAATTCATTGGGGAAAACAGG + Intergenic
1170469600 20:16655399-16655421 GGGAACTATTTCAGGAAAGCAGG - Intergenic
1170523552 20:17213683-17213705 AGGCACTCTTTAGGGAAAGCAGG - Intergenic
1172096389 20:32462522-32462544 TGTCACTGTTTGGGGAAAGAAGG + Intronic
1173698519 20:45044879-45044901 TCCAACTCTGTGGGAAAAGCAGG - Intronic
1174675148 20:52346604-52346626 TGGAAATCATGGGGGAAAGATGG + Intergenic
1174697802 20:52578231-52578253 TGGAACTCTTTGTGTAGTGCGGG - Intergenic
1175497598 20:59425299-59425321 TTGAGGACTTTGGGGAAAGCAGG - Intergenic
1177603883 21:23354235-23354257 TGTAACTGTGTGGGGAACGCAGG + Intergenic
1179391943 21:41002089-41002111 TGTAAATCTATGGTGAAAGCTGG + Intergenic
1183831855 22:40422427-40422449 AGGAACTCTGGGGGAAAAGCAGG + Intronic
1184660367 22:45962877-45962899 TGGAACACGTTGGAGAGAGCTGG + Intronic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
949330247 3:2914722-2914744 TGGAAGGGTTTGGGGAAAACTGG - Intronic
949335878 3:2974858-2974880 TGCAACTCTTTGGTGATGGCAGG - Intronic
950086063 3:10258793-10258815 TGGATCTCTTTGGGGAATGCAGG - Intronic
951512992 3:23525305-23525327 TGGACATCTTTGGGGCAAGAGGG + Intronic
953022287 3:39122490-39122512 TGGAACTCTTTGGGGAAAGCTGG - Intronic
956884483 3:73545331-73545353 AGAAACTCTTTGGGGAAGGGAGG + Intronic
957215321 3:77313518-77313540 TGGGAATGGTTGGGGAAAGCAGG - Intronic
960671786 3:120161490-120161512 TTGAACCCTTTGTGGAAAGAAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963843121 3:150128418-150128440 TGGAACCTTTTGGGAAAAGAAGG + Intergenic
963882510 3:150545115-150545137 TGTTACTCTTAGGGGACAGCAGG + Intronic
964086869 3:152829411-152829433 TGAAATTCTTTTGGAAAAGCTGG - Intergenic
965391500 3:168109958-168109980 TAGATCCCTTTGGGGAAGGCTGG + Intergenic
965449193 3:168816591-168816613 TAGAGCTCCTTGGGGAAACCAGG + Intergenic
967750955 3:193115828-193115850 TGTAAGTCATTGGGGAAAGATGG - Intergenic
969641630 4:8402214-8402236 TGGAGCTCCTTAGGGAAACCTGG + Intronic
970022391 4:11583741-11583763 TGGAACTCTTGGGCAAGAGCTGG - Intergenic
970133168 4:12893389-12893411 AAGAACTCCTTGGGGAAGGCAGG - Intergenic
971736623 4:30461460-30461482 TGAAACTTTCTAGGGAAAGCGGG - Intergenic
971910611 4:32792269-32792291 TGGAGCTCTTGGAGGAAGGCTGG - Intergenic
974287091 4:59882824-59882846 TGGAACTGTTTGATGAAAGTTGG + Intergenic
975508620 4:75167807-75167829 TGGACCTCTTAGGGAACAGCTGG - Intergenic
977079879 4:92511527-92511549 TGGTACTCTTTCAGGAAACCTGG + Intronic
979521723 4:121675083-121675105 TTGAACTCTTAGAGGAAAGAGGG - Intronic
984882348 4:184421168-184421190 TGAATCTCTTTGGGGACAGCTGG - Intronic
986182626 5:5407642-5407664 TGGAACACTATGGGGATGGCAGG + Intergenic
988136594 5:27179741-27179763 TGTAGCTCCTTGGGGAAAGGTGG - Intergenic
989631579 5:43488500-43488522 TGGAACTCTTTGGGAATGGATGG + Intronic
990372772 5:55137331-55137353 TGTACCTCTTTGCCGAAAGCTGG - Intronic
991055126 5:62311868-62311890 AGGAACTCTATGAGGTAAGCAGG + Intronic
991153170 5:63396474-63396496 TGGAAGGCTTTGTGGAAAACAGG - Intergenic
994737179 5:103569578-103569600 TTGATCCCCTTGGGGAAAGCTGG - Intergenic
996488800 5:124067982-124068004 TGGGTCTCTTTGGGAAAGGCTGG + Intergenic
997528045 5:134566100-134566122 TGGAACACTGAGGGGAAAGGAGG - Exonic
997607987 5:135190581-135190603 TGGCTCTGTTTGGGGGAAGCAGG - Intronic
1000155462 5:158547085-158547107 GGGCACTCTTTATGGAAAGCCGG + Intergenic
1002312050 5:178320730-178320752 TGAAACTCTTTGGCGGAAGCCGG - Intronic
1003508795 6:6762532-6762554 TGGCACTCGTTGGGGGAGGCGGG + Intergenic
1003688106 6:8324270-8324292 TGCAAATGTTTGGGGCAAGCTGG - Intergenic
1004024042 6:11801745-11801767 TGAAACTTTTTGGGGAAGGAAGG + Intronic
1005938997 6:30546917-30546939 TGGAATGTTTTGGGGAAAACTGG - Intronic
1007167925 6:39841392-39841414 GGGAACTCCTTGGGGAAAGGTGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010395140 6:75383106-75383128 TGGAGCTCTGTGGGGAATGATGG + Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1010981358 6:82373944-82373966 TGTGACTTTTTGGGGAGAGCAGG + Intergenic
1010982058 6:82379425-82379447 TGGGACTTTTTGGAGAGAGCAGG + Intergenic
1011507066 6:88057035-88057057 TGGAACTTTTTGGGGAAGCATGG - Intronic
1011516098 6:88155515-88155537 TGGAACTCTGTGTTGAGAGCAGG - Intronic
1012908910 6:105097585-105097607 GAAAAATCTTTGGGGAAAGCTGG - Exonic
1014895502 6:126895138-126895160 TGGGTCTCTTTGGGGAAGGCTGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015783452 6:136895808-136895830 TGAAACTCTTTGGTGAAGGGAGG - Intronic
1017788383 6:157774611-157774633 TGGCATACTTGGGGGAAAGCTGG + Intronic
1018195861 6:161355899-161355921 TGGGACTCGTTGGGTAAAGGGGG + Intronic
1019482042 7:1271329-1271351 TCGAACTCTTTGGCTCAAGCGGG - Intergenic
1020152529 7:5694442-5694464 TGGAAGTTTTGGAGGAAAGCAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1022644250 7:32215967-32215989 GTGAACTCTTTTGGGAAGGCTGG + Intronic
1023457366 7:40355034-40355056 TGGAACTCTATGGAGAAGGCAGG - Intronic
1025116078 7:56259537-56259559 TGGAACTCTTGGGCTCAAGCAGG + Intergenic
1026200530 7:68210752-68210774 TGGAACTCTTGGGCTCAAGCAGG + Intergenic
1026501518 7:70946990-70947012 TCAAGCTCTTTGAGGAAAGCTGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030788782 7:113697084-113697106 TGGAGCTTTCTGGGGAGAGCAGG + Intergenic
1033983274 7:147192389-147192411 TGGAACTTTTAGGAGAAAGAGGG - Intronic
1037802483 8:22043199-22043221 TGGAAAAATTGGGGGAAAGCCGG - Intronic
1037910268 8:22739944-22739966 TGTGGCTCTTTGGGGAAGGCTGG + Intronic
1038052159 8:23824272-23824294 TGGAACTCAGTGGGGATGGCTGG - Intergenic
1038546392 8:28428701-28428723 TGGAACTTTTAGGGGAGAGCTGG + Exonic
1040726409 8:50386420-50386442 TGCAATTCTTTGGGGGAGGCTGG + Intronic
1040727742 8:50403160-50403182 TGCAGATGTTTGGGGAAAGCAGG - Intronic
1041020345 8:53632427-53632449 GGCAACATTTTGGGGAAAGCAGG - Intergenic
1042873199 8:73416678-73416700 TGGAAGGCTGTGGGGAAACCTGG - Intergenic
1043413357 8:80023030-80023052 TAGAATTCTCTGGGGAAAGTAGG - Intronic
1044121583 8:88403555-88403577 TGTAAATCTTTGGAAAAAGCTGG - Intergenic
1047313656 8:123712931-123712953 TGGTACTCCTTGGGGCCAGCTGG + Intronic
1047761738 8:127959646-127959668 TGAAACTCTTTAAGGAAAGGAGG + Intergenic
1048848942 8:138626233-138626255 TGGATCTTTTAGGGGAAAGAAGG - Exonic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050612864 9:7371291-7371313 TGGAGTTCTTTGGGGAATGCTGG + Intergenic
1051683710 9:19634734-19634756 TAGAACTTTTTAGGGAAACCTGG + Intronic
1052089359 9:24308859-24308881 TGGGACCTGTTGGGGAAAGCGGG - Intergenic
1052101183 9:24447814-24447836 TAGATGCCTTTGGGGAAAGCTGG + Intergenic
1052820188 9:33132310-33132332 AGTCACACTTTGGGGAAAGCGGG - Intronic
1052986892 9:34494402-34494424 TGGAACTCTGAGGTGAAAGATGG + Intronic
1053336555 9:37278794-37278816 AGGAGAGCTTTGGGGAAAGCTGG + Intronic
1053447335 9:38163235-38163257 CGGAACTCTTTGGGATAAGTAGG - Intergenic
1054800615 9:69344738-69344760 TGGAACTTATTGGGCAAAGGAGG + Intronic
1055270792 9:74556197-74556219 TGGAACTATTTGTGGGAAGACGG + Intronic
1056432199 9:86539081-86539103 TGAAACTCTTAGGAGAAAACAGG + Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059210474 9:112510147-112510169 TGAAACTGTTTGGGAGAAGCTGG + Intronic
1060347306 9:122828278-122828300 TGGAGCTTTTGGGGGAAGGCTGG + Intronic
1060365897 9:123013202-123013224 TACAACTCTTTGGGGAAAGGTGG - Intronic
1062368634 9:136224712-136224734 CTGAACTCTTAAGGGAAAGCAGG + Intronic
1186057506 X:5665607-5665629 TGGGACTCTTGGGCAAAAGCGGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191832880 X:65433726-65433748 TAGGACCCTTTGGGGAAGGCTGG + Intronic
1192043165 X:67644364-67644386 AGTACCTCTTTGGGGAAAGTTGG - Intronic
1195445172 X:104944141-104944163 TGGAAATGTTTGTGGATAGCGGG - Intronic
1197130601 X:123001546-123001568 GGGAATTCTTTGGGAAAACCAGG - Intergenic
1199655671 X:149992981-149993003 TTGAACTCTTTGAGGAAGTCTGG + Intergenic
1200921832 Y:8620213-8620235 TGGAACTCTCAGGGAAAGGCAGG - Intergenic
1200922589 Y:8626679-8626701 TGGAGCTCTCTGGGAAAGGCAGG - Intergenic
1200984410 Y:9290545-9290567 AGGAGCTCTCTGGGGAAGGCAGG + Intergenic
1201749324 Y:17415247-17415269 TGGAACTCCTTGGAGAAACAGGG + Intergenic
1202126031 Y:21569699-21569721 AGGAGCTCTCTGGGGAAGGCAGG - Intergenic
1202152971 Y:21859698-21859720 AGGAGCTCTCTGGGGAAGGCAGG + Intergenic