ID: 953023889

View in Genome Browser
Species Human (GRCh38)
Location 3:39133884-39133906
Sequence GGTGCCCTGTATCCCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953023889_953023895 11 Left 953023889 3:39133884-39133906 CCTGCATGGGGATACAGGGCACC 0: 1
1: 0
2: 0
3: 20
4: 141
Right 953023895 3:39133918-39133940 TGGTACCTGCCCCAGAGTCTGGG 0: 1
1: 0
2: 2
3: 18
4: 174
953023889_953023899 20 Left 953023889 3:39133884-39133906 CCTGCATGGGGATACAGGGCACC 0: 1
1: 0
2: 0
3: 20
4: 141
Right 953023899 3:39133927-39133949 CCCCAGAGTCTGGGGCACAGAGG 0: 1
1: 0
2: 5
3: 40
4: 468
953023889_953023894 10 Left 953023889 3:39133884-39133906 CCTGCATGGGGATACAGGGCACC 0: 1
1: 0
2: 0
3: 20
4: 141
Right 953023894 3:39133917-39133939 ATGGTACCTGCCCCAGAGTCTGG 0: 1
1: 1
2: 1
3: 15
4: 158
953023889_953023896 12 Left 953023889 3:39133884-39133906 CCTGCATGGGGATACAGGGCACC 0: 1
1: 0
2: 0
3: 20
4: 141
Right 953023896 3:39133919-39133941 GGTACCTGCCCCAGAGTCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 236
953023889_953023892 -9 Left 953023889 3:39133884-39133906 CCTGCATGGGGATACAGGGCACC 0: 1
1: 0
2: 0
3: 20
4: 141
Right 953023892 3:39133898-39133920 CAGGGCACCACTTGGAGGAATGG 0: 1
1: 0
2: 2
3: 19
4: 191
953023889_953023901 21 Left 953023889 3:39133884-39133906 CCTGCATGGGGATACAGGGCACC 0: 1
1: 0
2: 0
3: 20
4: 141
Right 953023901 3:39133928-39133950 CCCAGAGTCTGGGGCACAGAGGG 0: 1
1: 3
2: 1
3: 43
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953023889 Original CRISPR GGTGCCCTGTATCCCCATGC AGG (reversed) Intronic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
900634646 1:3656802-3656824 GGTGCCATTTTTCCCCATCCAGG - Intronic
900973830 1:6005728-6005750 TGTGCCCTGTCTCCCCACGTGGG - Intronic
902376799 1:16033665-16033687 GGTGCCCTGTTTCATCTTGCTGG - Exonic
902381967 1:16056923-16056945 GGTGCCCTGTTTCATCTTGCTGG - Exonic
904985969 1:34549252-34549274 GGTGCATAGTAGCCCCATGCAGG - Intergenic
906128752 1:43443334-43443356 ACTGCCCTGTTTCCCCAGGCTGG + Exonic
906568540 1:46817443-46817465 GCTGCCATGTACCACCATGCAGG + Intronic
913349468 1:117842116-117842138 AGTGTGCTGTATCCCCATGTAGG - Intergenic
916323432 1:163531504-163531526 GCTGCCCTGTGTACCCATCCAGG + Intergenic
917529781 1:175824271-175824293 GTTGCCCTATGTCACCATGCTGG + Intergenic
923500742 1:234561516-234561538 GGCCCCCTGTATCTGCATGCAGG - Intergenic
1066194026 10:33081347-33081369 GGTGACCTGAATTCCCATGGAGG + Intergenic
1069071873 10:63998010-63998032 GGTGCATGGTATCTCCATGCAGG - Intergenic
1069643388 10:69971696-69971718 GGTCTTCTGTCTCCCCATGCAGG - Intergenic
1074772803 10:116744318-116744340 GCTCCCCTGCATACCCATGCTGG + Intergenic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1077184526 11:1230261-1230283 GGAGCCCTGGGTCCCCATGATGG + Intronic
1077303829 11:1859030-1859052 AGTCCCCTGTATCCCCCGGCAGG + Intronic
1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG + Intergenic
1080383723 11:31798540-31798562 GGTGCCCGCTACCCCCACGCCGG + Intronic
1080984542 11:37445793-37445815 GCTGGCCTGTATTCTCATGCAGG + Intergenic
1081642743 11:44767449-44767471 GGTGCCCTCTGTGCCCATGGTGG + Intronic
1085731259 11:79001358-79001380 GGTGCTCAGTAGCCCCATGCAGG - Intronic
1088108684 11:106235524-106235546 GGTTCCCTGTATCCCCAAAAAGG + Intergenic
1089730416 11:120515474-120515496 TGTGCCCTCCATACCCATGCAGG - Intronic
1090684395 11:129099917-129099939 AGTGCACAGTAGCCCCATGCAGG - Intronic
1091323523 11:134667856-134667878 GGTGCCCTGGGTCCACGTGCGGG + Intergenic
1092282374 12:7108158-7108180 GGTGCCCTGAATCCCCCATCTGG - Intronic
1105430728 13:20334719-20334741 GGTGCCCTTGAGCACCATGCAGG - Intergenic
1109945965 13:69432686-69432708 TGTGCCCTGAATTCCCCTGCAGG + Intergenic
1116282769 14:42929334-42929356 GGTGCTCAGTAGCTCCATGCAGG + Intergenic
1119643096 14:76329391-76329413 GGTTCCGTGAATCCCAATGCCGG + Intronic
1120723814 14:87916308-87916330 GGTGCCCTGTATGTTCACGCAGG + Intronic
1121915877 14:97836661-97836683 GCAGTCCTGTACCCCCATGCAGG + Intergenic
1122115562 14:99525705-99525727 GGTGCCCTGTGTCCCCACCTGGG + Intronic
1123063447 14:105604859-105604881 GCTTTCCTGTGTCCCCATGCAGG + Intergenic
1123087509 14:105723645-105723667 GCTTTCCTGTGTCCCCATGCAGG + Intergenic
1123126933 14:105953602-105953624 GGTGCTTGGCATCCCCATGCAGG - Intergenic
1123407396 15:20029422-20029444 GGTGCTCGGCATCCCCATGCAGG - Intergenic
1123516723 15:21036078-21036100 GGTGCTCGGCATCCCCATGCAGG - Intergenic
1125550059 15:40538419-40538441 GGTGCCCTGTGACCCCTTGAGGG - Intronic
1127098177 15:55534856-55534878 GGTGCATAGTAGCCCCATGCAGG - Intergenic
1129124847 15:73430762-73430784 GGTGCCCTGTTTTCACATCCAGG - Intergenic
1129379590 15:75156692-75156714 GGTGGTCTGTAGCCCCATGAGGG + Intergenic
1129675835 15:77632204-77632226 GGTGCCCTGCAACCCCAGGAGGG + Intronic
1132011609 15:98281440-98281462 AGTGACCTTTAACCCCATGCTGG + Intergenic
1132713341 16:1278896-1278918 AGGGCCCTGTAGCCCCATGCAGG + Intergenic
1133613648 16:7456014-7456036 GGGGCCCTGCATGACCATGCAGG - Intronic
1134605494 16:15567965-15567987 GGTGTCCTGTTTCCCCAGGATGG + Exonic
1136998521 16:35208040-35208062 GTTGCACTGTCTCCCCAGGCGGG + Intergenic
1137761879 16:50947830-50947852 CTTGCCATGTAGCCCCATGCAGG + Intergenic
1138017054 16:53438293-53438315 GCTACCCTGGATCACCATGCTGG - Intronic
1141620636 16:85235165-85235187 GGTGTCCTTTCTCCCCAGGCTGG + Intergenic
1141697290 16:85626095-85626117 GCTGCCCTGGGTCCCCATACTGG - Intronic
1141729282 16:85810866-85810888 AGGGCCCTGTCTCCCCACGCCGG + Intergenic
1142205599 16:88781518-88781540 GGCGCACTCTGTCCCCATGCTGG - Intronic
1144405729 17:14950994-14951016 GGTGGCCTGAATTCCCATGTCGG + Intergenic
1145001892 17:19311199-19311221 GGTGGCCTGTTTCCCACTGCAGG - Intronic
1146474651 17:33153202-33153224 GGGGCCCTGGGTGCCCATGCTGG - Intronic
1147140112 17:38455873-38455895 GGTGCCCTGCACCCCCATGGGGG - Intronic
1148793351 17:50185752-50185774 AGTGCCCAGAATCCCCAGGCAGG - Intronic
1151039522 17:70842496-70842518 GGTGCCATGTATTCCCTGGCAGG - Intergenic
1151928820 17:77217858-77217880 GGTGCCCTGCACGTCCATGCTGG + Intergenic
1152659139 17:81534456-81534478 GGTGCCTGCTGTCCCCATGCTGG + Intronic
1158497992 18:57973979-57974001 GGTGCCCTGTCTCCCCTTTGGGG + Intergenic
1161015270 19:1980053-1980075 GGTGCCCTGGGTCCCCATGGGGG + Intronic
1162447158 19:10730586-10730608 GGGTCCCTGCATCCCCAGGCAGG - Intronic
1163572335 19:18089936-18089958 GGGGCCCTGTGACCCCATACAGG + Intronic
1163729294 19:18940386-18940408 GGTGCCCGGGATCCCCAATCTGG + Intronic
1168270562 19:55247499-55247521 CGGGCCCTGTCTCCCCATGAGGG + Intronic
925180154 2:1812376-1812398 ACTGCTCTGTATCCCCATGATGG + Intronic
926645710 2:15287922-15287944 GGTGCTCAGAATGCCCATGCAGG - Intronic
926645723 2:15287980-15288002 GGTGCTCGGGATGCCCATGCGGG - Intronic
927592203 2:24366141-24366163 GGGGCCCTGCATCCTCAAGCTGG + Intergenic
928450126 2:31371202-31371224 GTTGCCCTATTTCCCCATGGGGG - Intronic
928811448 2:35232982-35233004 GTTGCACAGTATCCCCATGTAGG - Intergenic
932054950 2:68433781-68433803 TGTGCCCTGTGTCCCCAAGACGG - Intergenic
935336570 2:102022290-102022312 GGTGCCTGGTATCCCAATGCAGG + Intronic
937362218 2:121237295-121237317 GGGGCCCTGCATCACCCTGCCGG + Intronic
938946587 2:136217833-136217855 GGGGCACTGTATCCCCTTTCTGG + Intergenic
940621704 2:156121574-156121596 GGTGCCCTGTGTCCCAGTGGTGG + Intergenic
940910323 2:159204517-159204539 GGTGTGCTGTGTCCTCATGCTGG + Intronic
941967733 2:171316236-171316258 GGTGCCCGGCAGCCCCATGCCGG - Intergenic
942781443 2:179648029-179648051 GAGGCCCTGACTCCCCATGCTGG - Intronic
947229426 2:227870420-227870442 ACTGTCCTGTATCCCCATGGGGG + Intergenic
948281381 2:236750176-236750198 GAGGCCCTGAGTCCCCATGCTGG + Intergenic
1171089832 20:22274127-22274149 GGAGCTCTGCATTCCCATGCAGG + Intergenic
1171869220 20:30512634-30512656 GGTGCCCCCTATCCCCGTGAGGG - Intergenic
1174991272 20:55512932-55512954 GGTGCACAGTATCCCTATGCAGG - Intergenic
1176315283 21:5237041-5237063 GGTGCCCTGTGTCCCAATCATGG + Intergenic
1180077788 21:45472004-45472026 GGCACCCTGTAGCCCCGTGCAGG + Intronic
1182734991 22:32526889-32526911 GGTGCTCTGAAGCTCCATGCTGG + Intronic
1183393404 22:37558884-37558906 GGCTCCCTGAATCCCCATGCTGG - Intergenic
950595668 3:13979129-13979151 GGTCCCCTTTATCCACCTGCTGG + Intronic
953023889 3:39133884-39133906 GGTGCCCTGTATCCCCATGCAGG - Intronic
953162065 3:40430149-40430171 GGCGCCCTCCATCCCCAAGCCGG - Intergenic
961475662 3:127144897-127144919 CCTGCCCTGTATCCACATCCTGG + Intergenic
962685228 3:137841213-137841235 GGTGTCCTGTAACCCCATCCAGG - Intergenic
963914221 3:150842602-150842624 GGTGCACTGTAACCCCATGTAGG + Intergenic
968799439 4:2732641-2732663 GGTGCCCTGGCTCCCCATGGCGG - Intergenic
969342444 4:6550578-6550600 GTTGCCCTGGAGCCTCATGCAGG - Intronic
975403706 4:73965741-73965763 GGTGTGCTGTAGCCCCATGTAGG + Intergenic
975510921 4:75193415-75193437 GGTGCCTGGTAGCCCCATACAGG - Intergenic
978163723 4:105581120-105581142 GGTGCCCCGTAGCCCCATACAGG + Intronic
980545819 4:134260219-134260241 GGTGCCCTGTGTCCCAATCATGG - Intergenic
982331595 4:154187154-154187176 TGTGCCCAGTAACACCATGCAGG + Intergenic
983989137 4:174097020-174097042 GTGGCCCTGTATCCCCATTCAGG - Intergenic
984548304 4:181132485-181132507 GGTGTTCTGTATCCCCAAGTGGG + Intergenic
985857270 5:2439361-2439383 GCTGACCTGTGTCCTCATGCAGG + Intergenic
986301425 5:6481352-6481374 GGTGCTCATTATCCCCATGCAGG + Intronic
986723687 5:10578504-10578526 TCTGTCCTGTGTCCCCATGCGGG - Intronic
987914897 5:24200273-24200295 GGTGTGCAGTAGCCCCATGCAGG - Intergenic
990134744 5:52631566-52631588 GGTGCTTGGTAACCCCATGCAGG + Intergenic
993799754 5:92318454-92318476 GGTGAGCAGTTTCCCCATGCTGG + Intergenic
996265480 5:121534691-121534713 GGTGCTCACTAACCCCATGCAGG - Intergenic
998906730 5:146913085-146913107 GAGGCCCTGTCTGCCCATGCAGG + Intronic
1002043129 5:176528655-176528677 GGTGCTCTGTCTGCCCATCCTGG + Exonic
1002043391 5:176529709-176529731 GGTCCCATGGAGCCCCATGCTGG - Exonic
1002579823 5:180201128-180201150 CGTGCTCTGTTTCCCCATGTAGG - Intronic
1004424837 6:15500284-15500306 GCTGCCCTGTGTCCTCACGCAGG + Intronic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1006962996 6:37952774-37952796 GGTGCTCAGCAGCCCCATGCAGG + Intronic
1010682149 6:78809507-78809529 GAGTCCCTGTAGCCCCATGCAGG + Intergenic
1013992218 6:116266078-116266100 GGTGTGCAGTAGCCCCATGCAGG + Intronic
1014671799 6:124313720-124313742 GGTGGCCGGTTTCCCCATGCTGG + Intronic
1018170796 6:161141520-161141542 GGTGCCCTGTGGCCCCAACCTGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1024684950 7:51734738-51734760 GGTGCCCTGCATCCCAGTGGTGG - Intergenic
1027188877 7:75986684-75986706 GGAGCCCGGTGCCCCCATGCAGG - Exonic
1030376087 7:108755224-108755246 GGTGCATGGTAGCCCCATGCAGG - Intergenic
1035043185 7:155945792-155945814 GGTGCCCTGGGTTCCGATGCTGG + Intergenic
1037875958 8:22548614-22548636 GATGCCCTGTATCTCCATGGGGG + Intronic
1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG + Intergenic
1038325737 8:26571450-26571472 GGTGCCCTTTGTCCCCATCAGGG + Intronic
1039966327 8:42286869-42286891 GGTGCCCTGTGCCACCCTGCAGG + Intronic
1041404509 8:57483362-57483384 GGTGCACAGTAGCCCCATGTGGG - Intergenic
1043738205 8:83774576-83774598 AGTGCACGGTAGCCCCATGCAGG - Intergenic
1047761940 8:127961012-127961034 GGCACCCTGTGTCCCCAGGCAGG - Intergenic
1048683419 8:136873259-136873281 GATGCCCTGTGTCAGCATGCTGG - Intergenic
1048853069 8:138662852-138662874 GGAGCCCTGTAGCCCTGTGCTGG + Intronic
1049391949 8:142376252-142376274 GGTGCCCTGTTTTCCCCTGAGGG + Intronic
1050800599 9:9607931-9607953 GCTGCCCTTTATCCGAATGCAGG - Intronic
1050871309 9:10573652-10573674 GGTGCGCTGTAGCCCCGTGCAGG - Intronic
1053530701 9:38878586-38878608 GGTGTGCAGTAGCCCCATGCAGG - Intergenic
1054202924 9:62103019-62103041 GGTGTGCAGTAGCCCCATGCAGG - Intergenic
1054344969 9:63905585-63905607 GGTGCCCTGTGTCCCAATCATGG + Intergenic
1054635439 9:67485346-67485368 GGTGTGCAGTAGCCCCATGCAGG + Intergenic
1057108598 9:92445286-92445308 GGTGCGTGGTAGCCCCATGCAGG + Intronic
1057822405 9:98342633-98342655 GGTGCCCTGGATGGCCAGGCTGG - Intronic
1062710698 9:137973670-137973692 GGTGAACTCTGTCCCCATGCTGG + Intronic
1203454169 Un_GL000219v1:149579-149601 GGTGCCCTGTGTCCCAATCATGG + Intergenic
1185748816 X:2593867-2593889 GGTGCCTCGTGTCCCCTTGCAGG - Intergenic
1189300641 X:39949717-39949739 GGTGCCCTGCTGGCCCATGCTGG - Intergenic
1191800529 X:65073842-65073864 GGTGCACTGTAGCCCTGTGCAGG + Intergenic
1192246350 X:69374973-69374995 GGTGCCATTTTTCTCCATGCAGG - Intergenic
1192919333 X:75689951-75689973 TGTGCTCAGTAACCCCATGCAGG - Intergenic
1196583968 X:117408675-117408697 GGTGCACAGTAGCCCCGTGCAGG - Intergenic
1197790321 X:130248263-130248285 GGTGCACAGTAGCCCCATACAGG - Intronic
1198779640 X:140221278-140221300 GGTGCATGGTAGCCCCATGCAGG - Intergenic
1201978406 Y:19879939-19879961 GGTGTATTGTAGCCCCATGCAGG - Intergenic