ID: 953024521

View in Genome Browser
Species Human (GRCh38)
Location 3:39137180-39137202
Sequence GTCTAACACCTGCAGCTACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953024511_953024521 26 Left 953024511 3:39137131-39137153 CCAGGTGAGGGCCACACGGGCAG 0: 1
1: 0
2: 3
3: 26
4: 242
Right 953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG 0: 1
1: 0
2: 0
3: 9
4: 127
953024514_953024521 15 Left 953024514 3:39137142-39137164 CCACACGGGCAGGCCACCGGCCT 0: 1
1: 0
2: 2
3: 10
4: 141
Right 953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG 0: 1
1: 0
2: 0
3: 9
4: 127
953024515_953024521 2 Left 953024515 3:39137155-39137177 CCACCGGCCTGTGTCTGATACCC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG 0: 1
1: 0
2: 0
3: 9
4: 127
953024518_953024521 -5 Left 953024518 3:39137162-39137184 CCTGTGTCTGATACCCAGGTCTA 0: 1
1: 0
2: 0
3: 17
4: 396
Right 953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG 0: 1
1: 0
2: 0
3: 9
4: 127
953024516_953024521 -1 Left 953024516 3:39137158-39137180 CCGGCCTGTGTCTGATACCCAGG 0: 1
1: 0
2: 2
3: 32
4: 551
Right 953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953024521 Original CRISPR GTCTAACACCTGCAGCTACA TGG Exonic
903286531 1:22280734-22280756 TTCTAACACATGCTGCAACATGG + Intergenic
903478321 1:23635512-23635534 GTCTAACACCAGCAGCCCCCCGG - Intronic
904441231 1:30533303-30533325 TTCTAACACCTACAGCTCAAAGG + Intergenic
905472846 1:38206559-38206581 GTCCAACAGCTTCAGCTAAAAGG + Intergenic
911069897 1:93824430-93824452 GGCTAACTCCTTCAGCTAAAAGG + Intronic
912040759 1:105387029-105387051 GTCTAACACTTACACATACATGG - Intergenic
914341154 1:146761739-146761761 TGCTAACACCTCCAGCCACATGG + Intergenic
924004153 1:239588879-239588901 TTATAACACCTGCAGGTCCAAGG - Intronic
1065686297 10:28288691-28288713 GTCTGAAAACTGCAGCTCCAAGG + Intronic
1074089428 10:110234537-110234559 GTATAACACCTGCATCTATGGGG - Intronic
1075873414 10:125787505-125787527 GTCTAACACCTCCTGCTGCTTGG + Intronic
1078222422 11:9363020-9363042 TTCGAAAACCTGCAGCAACAAGG + Intergenic
1079310182 11:19358414-19358436 CTCTAACATATGCAGTTACATGG - Intronic
1086179587 11:83934571-83934593 GTGTAGCACCTGAACCTACAAGG + Intronic
1087796754 11:102462110-102462132 ATATAACACCTGCAGGGACATGG - Intronic
1089881412 11:121777129-121777151 GTCTAAGAAATGCACCTACATGG + Intergenic
1091180799 11:133602631-133602653 GACTGACACCTGCAACTACGTGG - Intergenic
1093759820 12:22896459-22896481 TTCAAACACCTAGAGCTACAGGG + Intergenic
1094455237 12:30624642-30624664 GTCTGACAGCAGCAGCTGCAAGG + Intergenic
1098519265 12:71417310-71417332 CTCTAACAGCTGGAGCAACAGGG - Intronic
1099714264 12:86270571-86270593 TTCTAACACATGCTGCAACATGG - Intronic
1103053226 12:117798919-117798941 TTCTAACACATGCTGCAACATGG + Intronic
1104531347 12:129573777-129573799 GTCTTCCACATGCAACTACATGG + Intronic
1113086685 13:106576285-106576307 TTCTGACACATACAGCTACAGGG - Intergenic
1114622895 14:24108461-24108483 GGCTTACACCTGTAGCTACTCGG - Intronic
1116273979 14:42806678-42806700 GTTTAACTCCTGCAGCAAAAAGG + Intergenic
1127745997 15:61973734-61973756 GTCTACCACCCACATCTACAAGG + Intronic
1138050075 16:53767079-53767101 CTCCCAGACCTGCAGCTACAGGG + Intronic
1138449066 16:57082286-57082308 GTCTAACACCTGCCTCTGCCAGG + Intronic
1139993131 16:70955669-70955691 TGCTAACACCTCCAGCCACATGG - Intronic
1143188999 17:5027844-5027866 GGCTCACACCTGTAGCTACTTGG + Exonic
1147993557 17:44349610-44349632 CTCTACCACCTGCAGATAAAAGG + Intronic
1148127234 17:45243104-45243126 GTCTAGCTCCTGAAGGTACAGGG - Exonic
1151012016 17:70510511-70510533 GCCTAACACCAGAAGCCACATGG - Intergenic
1152869147 17:82742527-82742549 TTCTAACACCTGCTACAACATGG - Intronic
1153954745 18:10086756-10086778 GACTGACACCTGCAGACACACGG - Intergenic
1155782592 18:29856235-29856257 GTCAAAGATCTGGAGCTACATGG - Intergenic
1156049535 18:32915578-32915600 GTCTAACACCCACAGTCACATGG - Intergenic
1156230269 18:35147045-35147067 GTCTAATATCTGAATCTACAAGG - Intergenic
1159142623 18:64415939-64415961 TTCTGACACATGCAGCAACATGG - Intergenic
1163282501 19:16325950-16325972 CACTCACACCTGCAGCTACGCGG + Exonic
1163529790 19:17842603-17842625 CTCCAACCCCTGCAGCTACAAGG - Exonic
1163759533 19:19127957-19127979 TTCTAACACCTGCTACAACATGG + Intronic
1166209763 19:41298768-41298790 GGCTAGCCCCTGCAGCTTCATGG - Intronic
1166390033 19:42403849-42403871 GTCTGGCACCTGTAGCCACATGG + Intronic
1168367711 19:55803570-55803592 GTCTAATACCCGCATCTATAAGG + Intronic
926591976 2:14749984-14750006 GGCTAAAACCTGCTGCTGCATGG + Intergenic
928411370 2:31056784-31056806 GTCTAACTGCTGCAGTTTCAAGG + Intronic
928462355 2:31486288-31486310 GTCCCACACATGTAGCTACATGG - Intergenic
929530734 2:42750377-42750399 CTCTAACACCTGCTGTTAGAGGG + Intronic
929654885 2:43720906-43720928 GTCTATCACCTACACCTACAAGG + Intronic
933795823 2:85918755-85918777 GTCCTACACCTCCAGCTACTGGG + Intergenic
934167500 2:89307479-89307501 GTCAAACACCTGCCCCTAGATGG - Intergenic
934199775 2:89874967-89874989 GTCAAACACCTGCCCCTAGATGG + Intergenic
934975249 2:98797509-98797531 GTCTGCCGCCTGCAGCAACAGGG - Exonic
935483108 2:103617621-103617643 GTCTAACTCCTGTGACTACAAGG + Intergenic
937226072 2:120369642-120369664 GCCTAATACCTGCTGCAACATGG - Intergenic
942146701 2:173034286-173034308 GTCTAACACCTCCAGCCAACGGG - Intronic
942403911 2:175632626-175632648 TTTTAACATCTGGAGCTACATGG + Intergenic
944178744 2:196863405-196863427 TTCTATCATCTGCAGCAACATGG + Intronic
944506056 2:200412435-200412457 GTCTAACATCTTCAGCTGCAGGG - Intronic
946010251 2:216558715-216558737 CTCCACCACCAGCAGCTACAAGG + Intronic
948681746 2:239639897-239639919 GTCACACACCTTCAGCTGCATGG + Intergenic
1170778605 20:19403213-19403235 GTCCAACATCTGAAGGTACATGG + Intronic
1170798176 20:19568443-19568465 TTCTAACACATGCTGCAACAGGG + Intronic
1172126698 20:32628782-32628804 CTCTCTCACCTGCAGCTCCAGGG - Intergenic
1173706664 20:45115119-45115141 GATTAACACCTGCAGCCTCAGGG + Exonic
1174515685 20:51090707-51090729 GTCCCACAGCTACAGCTACAGGG + Intergenic
1174554739 20:51386064-51386086 CTCTAGAACCTGCACCTACAGGG - Intergenic
1175234916 20:57503165-57503187 GACTGTCGCCTGCAGCTACAGGG - Intronic
1176076334 20:63250043-63250065 GTCAAACACCTGCCTCTCCAGGG + Exonic
1179549941 21:42137584-42137606 GTCCAACAACTTCAGCTACCAGG + Exonic
1180998051 22:19975259-19975281 GACGAACACCTGCAGGGACAGGG - Intronic
1181471756 22:23145067-23145089 GTCTATCTTCTGCAGCTGCAGGG + Intergenic
1181515413 22:23408576-23408598 TTCTAACACATGCTGCTACATGG + Intergenic
1182789160 22:32934545-32934567 GTCTAAAACCTTCAGCACCATGG + Intronic
1183114303 22:35678021-35678043 CTCTGACACCTGCAGCTTGAAGG + Intergenic
950880058 3:16316387-16316409 GTCCATCCCCTGCAGCTACTTGG - Exonic
953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG + Exonic
953906850 3:46872647-46872669 GTCTCACAGCAGCAGCTGCAGGG + Intronic
958776386 3:98487654-98487676 GGATAACACCTGCAGCTCCATGG + Intergenic
961823770 3:129588330-129588352 GCCTAACAACTGCAGCCTCATGG + Intronic
962926243 3:139995777-139995799 GTCTCTAATCTGCAGCTACATGG + Intronic
963284630 3:143421850-143421872 GTCTAATACCAGAATCTACAGGG + Intronic
965095487 3:164219647-164219669 GTTTAACTCCTGCAGCAACAAGG - Intergenic
965293758 3:166917155-166917177 GTCGTACAGTTGCAGCTACAAGG - Intergenic
965683188 3:171273217-171273239 GTCTAAAGCCTGGAGCTACAGGG + Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
968022410 3:195405118-195405140 GTCTAACTCCTACAAATACAAGG + Intronic
968783211 4:2598973-2598995 GTCAGACCCCTGCAGATACAAGG - Intronic
972879876 4:43410170-43410192 TTCTAAGACCTACAGCTACCTGG - Intergenic
978228428 4:106367214-106367236 GTCCAACACCTGGACCTGCAGGG + Intergenic
979487344 4:121283852-121283874 GTCTAAAGCCTGAAGCCACAGGG - Intergenic
982265183 4:153532057-153532079 ATATAACCCCTGCTGCTACAAGG - Intronic
983431392 4:167655956-167655978 GTCTGACACATAGAGCTACATGG + Intergenic
983831245 4:172330256-172330278 GTCTGACACCCAGAGCTACATGG - Intronic
986755037 5:10827459-10827481 GTCTAACATCTGTATCTCCAGGG + Intergenic
989444889 5:41515911-41515933 TTCTAACACCTGCCACAACATGG + Intergenic
991438721 5:66623169-66623191 GGCTGACATCTGTAGCTACAAGG + Intronic
993902198 5:93592101-93592123 TTCTAACACCTTCATCTACAAGG - Intronic
995420122 5:111955402-111955424 ATCTAACACCTATAGATACAAGG - Intronic
1004074417 6:12331984-12332006 GTCTAACACTTTCACCTACTTGG + Intergenic
1007868706 6:45007126-45007148 GTATAACACCGGAAGCTAGAAGG - Intronic
1011264418 6:85500132-85500154 GTCTGGGACCTGCAGCAACAGGG - Intergenic
1014326351 6:120000346-120000368 TTCTCAAATCTGCAGCTACAGGG + Intergenic
1020229463 7:6306575-6306597 TTCTGACACCTGCTGCAACACGG + Intergenic
1022192012 7:28025735-28025757 GTCCAACATCTGCTGCTGCAAGG - Intronic
1026004107 7:66587435-66587457 GGCTACCACATGCTGCTACAGGG + Intergenic
1026027132 7:66754569-66754591 GGCTACCACATGTAGCTACAAGG - Intronic
1030246430 7:107388669-107388691 GTATAAAACCTGCAGTTTCATGG + Intronic
1036721844 8:11183022-11183044 TTCTAACACATGCTGCAACATGG - Intronic
1038986333 8:32815372-32815394 TTCTATCATCTGCAGCAACATGG + Intergenic
1040574084 8:48635651-48635673 GACTAATACATGAAGCTACATGG - Intergenic
1041299969 8:56401222-56401244 GTTGAACACCAGCAGCCACATGG - Intergenic
1043396416 8:79842267-79842289 GTCTGACACACACAGCTACATGG + Intergenic
1045006345 8:97919805-97919827 ATCTCACACATGCAGCTACCTGG - Intronic
1046184076 8:110690346-110690368 CCCTCACACCTGCAGCTGCATGG + Intergenic
1049124325 8:140773288-140773310 TTCTAACTCCAGCACCTACATGG - Intronic
1052526284 9:29623728-29623750 GGCTGACACCAGCATCTACATGG - Intergenic
1056271917 9:84955155-84955177 TTTTAGCACCAGCAGCTACAGGG + Intronic
1059058398 9:111008658-111008680 GTCTCACACATGGATCTACATGG + Intronic
1061287170 9:129630649-129630671 GCCTGACTCCTGGAGCTACAGGG - Intronic
1061648298 9:132024726-132024748 GTCTAAGGCCTGCAGAAACAAGG + Intronic
1062560753 9:137140844-137140866 TTCAAACAGCTGCAGCTGCAGGG + Intronic
1062598827 9:137311110-137311132 GTCCAACACCTCCAGCCCCAGGG - Intronic
1062646107 9:137549161-137549183 GTCAAACATCTGTAGCCACATGG - Intronic
1187401376 X:18963379-18963401 GACTATCACCTGCAGCTCCCAGG + Intronic
1188933027 X:36138166-36138188 GTCAAACACCTGAATCTGCATGG + Intronic
1191850127 X:65580143-65580165 CTCAAACACCTGCAGCAACTTGG - Intergenic
1192914841 X:75640780-75640802 GTCTAATAACTTCAGATACAAGG + Intergenic
1197663585 X:129199522-129199544 TTCTGACACATGCTGCTACATGG + Intergenic
1197700920 X:129598977-129598999 TTCTGACACATGCTGCTACATGG + Intergenic
1199393905 X:147311996-147312018 GTCTGACACACACAGCTACACGG + Intergenic
1201685030 Y:16691912-16691934 TTCTGACACCTGCTGCAACATGG - Intergenic
1202250277 Y:22864167-22864189 GTCTAACACATAGAGCTACTTGG + Intergenic
1202403266 Y:24497915-24497937 GTCTAACACATAGAGCTACTTGG + Intergenic
1202467515 Y:25172166-25172188 GTCTAACACATAGAGCTACTTGG - Intergenic