ID: 953026991

View in Genome Browser
Species Human (GRCh38)
Location 3:39151229-39151251
Sequence TCTGGGGTTCCTCGGCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953026991_953027002 14 Left 953026991 3:39151229-39151251 CCACACCGCCGAGGAACCCCAGA 0: 1
1: 0
2: 1
3: 5
4: 89
Right 953027002 3:39151266-39151288 CTGAGAGCCAGGCTTCTTCTGGG 0: 1
1: 0
2: 2
3: 35
4: 265
953026991_953026998 3 Left 953026991 3:39151229-39151251 CCACACCGCCGAGGAACCCCAGA 0: 1
1: 0
2: 1
3: 5
4: 89
Right 953026998 3:39151255-39151277 AGGCCCTGAATCTGAGAGCCAGG 0: 1
1: 0
2: 2
3: 25
4: 249
953026991_953027001 13 Left 953026991 3:39151229-39151251 CCACACCGCCGAGGAACCCCAGA 0: 1
1: 0
2: 1
3: 5
4: 89
Right 953027001 3:39151265-39151287 TCTGAGAGCCAGGCTTCTTCTGG 0: 1
1: 0
2: 1
3: 22
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953026991 Original CRISPR TCTGGGGTTCCTCGGCGGTG TGG (reversed) Intronic
901020770 1:6254228-6254250 TGTGGGGTGCCTGGGTGGTGCGG - Intronic
902902902 1:19532488-19532510 TCTGGTGTTCATCGGAGGTCAGG - Intergenic
903172872 1:21564382-21564404 TGTGGGATTTCTCTGCGGTGGGG + Intronic
904874626 1:33644558-33644580 TCTGGGTGTCCTCAGCTGTGTGG + Intronic
908396325 1:63728770-63728792 GCTGGCGTTCCTGGGAGGTGGGG + Intergenic
922545046 1:226450424-226450446 TCTGGGGTTCCTTGGCCAAGAGG - Intergenic
1066080839 10:31928947-31928969 TCTGGGGTGGCTAGGGGGTGCGG + Intergenic
1067685774 10:48465358-48465380 CCTGGGCTTCCTCTCCGGTGTGG - Intronic
1069640553 10:69952695-69952717 TCTCAGGTTCCTGGGGGGTGGGG + Intronic
1073212646 10:101817830-101817852 TCGGCGGTTCCTCTGCGGTGTGG - Exonic
1076487439 10:130833760-130833782 GCTGCGCTTCCTCGGCGGCGGGG + Intergenic
1078489420 11:11755442-11755464 TCTGTGCTGCCTCAGCGGTGAGG + Intergenic
1080014892 11:27493776-27493798 TTTGTTGTTCCTCGGCTGTGTGG + Intergenic
1081803799 11:45878261-45878283 TCTGGGGTTCCTGGGCCTTAAGG - Intronic
1082990778 11:59205612-59205634 TCTGGGGTTCCTCTTTGGAGTGG + Exonic
1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG + Intergenic
1096600063 12:52722738-52722760 TCTGAGCTTCCTAGGTGGTGGGG - Intergenic
1103998524 12:124845316-124845338 TTTGGGGTTCATCCGTGGTGTGG - Intronic
1104001738 12:124864327-124864349 TCTGGGGTTCCTGGGTGGGCTGG - Intronic
1105587986 13:21762243-21762265 TCTTGGGTTCCTGGGCTCTGAGG + Intergenic
1105705431 13:22965126-22965148 TCTGTGGTCCCTCGGGGCTGGGG + Intergenic
1105858333 13:24390111-24390133 TCTGTGGTCCCTCGGGGCTGGGG + Intergenic
1112602297 13:100868665-100868687 CCTGAGGTCCCTCGGGGGTGGGG + Intergenic
1113489055 13:110677546-110677568 TCTGGGTTTCCGTGGCGGGGTGG - Intronic
1113489088 13:110677693-110677715 TCTGGGTTTCCGTGGCGGGGTGG - Intronic
1113489096 13:110677719-110677741 TCTGGGTTTCCGTGGCGGGGTGG - Intronic
1113903588 13:113809119-113809141 TCTGTGGTTCCTGGGGGGAGGGG + Intronic
1113903649 13:113809343-113809365 TCTGTGGTTCCTGGGGGGAGGGG + Intronic
1113903703 13:113809546-113809568 TCTGTGGTTCCTGGGGGGAGGGG + Intronic
1113903713 13:113809573-113809595 TCTGTGGTTCCTGGGGGGAGGGG + Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1119771777 14:77224645-77224667 TCTGGAGTTTCTGGGTGGTGGGG - Intronic
1120190901 14:81438204-81438226 TCTGGTGTTCCTCCCAGGTGAGG - Intergenic
1122972645 14:105158675-105158697 TGGGGGGTTCCTGGGCAGTGAGG - Intronic
1123021203 14:105398703-105398725 TCTGGGGTTCGGCGGGGGGGCGG - Intronic
1127648019 15:60976737-60976759 TCAGGGTTTCCTTGGAGGTGTGG - Intronic
1136588465 16:31202627-31202649 TCTTGAGCTCCTCGGCGGTCAGG + Exonic
1141777713 16:86135295-86135317 TCTGCTCTTCCTGGGCGGTGTGG + Intergenic
1142214959 16:88825601-88825623 TCTGGGGTGCCTGGGCGGCCGGG + Intronic
1144661678 17:17074779-17074801 TTCGGGGTTCCTCGGTGTTGTGG + Intronic
1148588884 17:48800733-48800755 TCTCCTGTTCCTCGGTGGTGTGG + Intronic
1150218200 17:63481762-63481784 TCTGGGGTTCCCCGGTTCTGGGG + Intergenic
1150222143 17:63501659-63501681 TATGGGGATCCTCGAAGGTGAGG - Intronic
1152859449 17:82687080-82687102 TCTGGGCATCATCGGGGGTGTGG - Intronic
1156451021 18:37266569-37266591 GCAGGGGGTCCGCGGCGGTGGGG + Exonic
1156811604 18:41259742-41259764 TCTGGGTTTCCATGGCGCTGTGG + Intergenic
1158213017 18:55071089-55071111 TCTGGGATTCACCTGCGGTGGGG - Intergenic
1161587303 19:5112642-5112664 TCTGGGACTCCTGGGCGGTCTGG + Intronic
1162792420 19:13069948-13069970 TCTGGGCTTCCCCGGGGGAGGGG - Intronic
1165494172 19:36142076-36142098 TCTGGGTTTCCTCGAGGGTGGGG + Intronic
1167509165 19:49887341-49887363 GCTGGGGAACCTCGGAGGTGAGG - Intronic
926136416 2:10339853-10339875 CCTGGGGTTCCTGTGCGTTGAGG + Intronic
927216697 2:20671449-20671471 GCTGGGGATCCTCGGCCGCGTGG - Exonic
928234949 2:29531207-29531229 TCTGGGGTCCCTCAACGCTGAGG + Intronic
931719438 2:65056560-65056582 TCGGGGGTGCCGCGGCGCTGGGG + Intronic
934165055 2:89286793-89286815 TCTGGGGCTCCTTCGCGGTTCGG - Intergenic
934202218 2:89895669-89895691 TCTGGGGCTCCTTCGCGGTTCGG + Intergenic
935380287 2:102444789-102444811 TCTAGGGTTCCTGGGAGGTGAGG + Intronic
944811134 2:203328440-203328462 CCTGGGTTTCCTTGGCGCTGCGG + Exonic
945944318 2:215980293-215980315 TCTGGGGCTCCAGGGCAGTGAGG + Intronic
948309654 2:236975529-236975551 TTTGGGGTTCCTCGGCTCTTAGG + Intergenic
948660478 2:239503535-239503557 TCTGGGGTTCCTGGGCTGTGGGG - Intergenic
1172665190 20:36594188-36594210 TCTGGGGTTGCTAAGTGGTGAGG + Intronic
1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG + Intergenic
1173503107 20:43567514-43567536 CATGGGGTTCTTCGGGGGTGAGG + Intronic
1173865221 20:46308630-46308652 GCTGGGGTTCCCCGGCTGCGGGG - Intergenic
1179493376 21:41756076-41756098 TGTGGGGGTCCTCTGCAGTGGGG - Intronic
1179519529 21:41932966-41932988 TCAGGGGTTTGTCGGCGGAGAGG + Intronic
1179723574 21:43329639-43329661 TCTGGGGGTCCTCTGGGTTGAGG + Intergenic
1182362618 22:29755867-29755889 TCTGGTGTGCCTTGGCTGTGGGG - Intronic
1183776717 22:39970958-39970980 GCTGGGGTTCCACAGCGGGGAGG + Exonic
953026991 3:39151229-39151251 TCTGGGGTTCCTCGGCGGTGTGG - Intronic
969709506 4:8834681-8834703 TCTGGTGTTCCTCTGTGGTGAGG - Intergenic
975733148 4:77357027-77357049 TCTGAGGTTCCTCAGGTGTGGGG + Intronic
990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG + Intergenic
998018706 5:138752977-138752999 TCTGGGATTCCGCCGGGGTGGGG + Intronic
999692641 5:154162015-154162037 TCTGAGGTTCCTGGGGGATGAGG - Intronic
1005061151 6:21778159-21778181 TGTGGGCTTCCTGGGGGGTGAGG + Intergenic
1005835842 6:29708903-29708925 TCTGGGCTTCCTCAGATGTGGGG - Intergenic
1005841844 6:29748865-29748887 CCTGGCGGTCCTCGGCGGAGCGG - Intergenic
1006058634 6:31403715-31403737 CCTGGCGGTCCTCGGCGGAGCGG + Intronic
1007137855 6:39540098-39540120 TCTGGGTTTCCTAGGCGGAAGGG + Exonic
1012596557 6:101048054-101048076 ACTGGGGCTTCTCGGGGGTGTGG - Intergenic
1019358921 7:594901-594923 TCTGGGGTCCCTTGGTGGTCTGG - Intronic
1031620870 7:123932152-123932174 TTCTGGGTTCCTCGGCTGTGGGG + Intronic
1032021393 7:128408875-128408897 TAAGGGGCTCCTCGGCAGTGGGG - Intronic
1038982469 8:32775044-32775066 TCTTGGGTTCCTGGGTGGAGAGG - Intergenic
1042155666 8:65841817-65841839 CCTGGGGCTCCTCGGCCGAGAGG + Exonic
1047040852 8:120993625-120993647 GCTGGGGTTACTCTGAGGTGTGG - Intergenic
1049208169 8:141373007-141373029 CCTGGGGTTCCCGGGCTGTGGGG - Intergenic
1049296883 8:141845493-141845515 TTTGGGCTTCCTCAGGGGTGGGG - Intergenic
1056733217 9:89183358-89183380 TCTGGGGGTGCTCAGCTGTGGGG - Intergenic
1060660042 9:125399906-125399928 ACTGGGGGTCCTCAGCGGGGTGG + Intergenic
1062122185 9:134839711-134839733 TCTCTGGCTCCTCGCCGGTGGGG + Intronic
1190135945 X:47798010-47798032 TCTGGGGTCCCTCAGCTGTGGGG + Intergenic
1192149038 X:68700465-68700487 GCAGGGGTTCCTCTGTGGTGGGG - Intronic