ID: 953027239

View in Genome Browser
Species Human (GRCh38)
Location 3:39152372-39152394
Sequence GGCTCAGCACCGGGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953027233_953027239 0 Left 953027233 3:39152349-39152371 CCAGATTTGCATTTTAAAAACGT 0: 1
1: 0
2: 3
3: 68
4: 501
Right 953027239 3:39152372-39152394 GGCTCAGCACCGGGAGTGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953027239 Original CRISPR GGCTCAGCACCGGGAGTGGA GGG Intronic
900458897 1:2790749-2790771 AGCTCTGCCCTGGGAGTGGAGGG - Intronic
900545002 1:3223750-3223772 GGATCAGCCCCCGGAATGGAGGG + Intronic
901769704 1:11524054-11524076 GGGTGAGCACTGGGGGTGGAGGG + Exonic
902515232 1:16986424-16986446 GTCTCAGCAGCGGGAGAGAAGGG - Intronic
902988507 1:20170480-20170502 GGCACAGCACCGGCACTGGGCGG + Intronic
904078497 1:27857453-27857475 GTCTCAGCACGGGCAGTGAATGG + Intergenic
904883380 1:33717345-33717367 TGCTCTGCACTGGGAGAGGATGG + Intronic
904908601 1:33917077-33917099 GGCTGTGCTCCAGGAGTGGATGG - Intronic
906461330 1:46036909-46036931 GCCTCAGCACTGGAGGTGGATGG + Intergenic
908622365 1:65998404-65998426 GGCTCCTCACCGAGAATGGATGG - Intronic
912643972 1:111373175-111373197 GGCTCAGCACCTTGAAGGGAAGG + Intergenic
914439257 1:147689283-147689305 GCCTCAGCCCCTGGAGTAGATGG - Intergenic
915040712 1:152966094-152966116 AGCTGAGCACTGGTAGTGGAAGG - Intergenic
915285605 1:154850128-154850150 GGCTCTGCCCCTAGAGTGGAGGG - Intronic
920382107 1:205541142-205541164 GGCTGAGGAAGGGGAGTGGAGGG - Intergenic
921221999 1:212979974-212979996 GGGTCAGCTCTGGGAGAGGAGGG + Intronic
921903762 1:220475643-220475665 CGCACAGCACCGGGACTGGCAGG - Intergenic
922485496 1:225970151-225970173 CGCACAGCACCGGGACTGGCAGG + Intergenic
924727217 1:246682066-246682088 GTCTCAGCTACAGGAGTGGAAGG + Intergenic
924947711 1:248857488-248857510 GGCTCAGGACCTGGAGGGGTGGG + Exonic
1071725143 10:88190984-88191006 GGCTCAACTCAGGGATTGGAAGG + Intergenic
1074198225 10:111207954-111207976 CTCTCAGCACCTGGGGTGGAGGG - Intergenic
1074941173 10:118237094-118237116 GGCTCTGCAACTGGATTGGAAGG - Intergenic
1074969462 10:118523867-118523889 GGATCAGCACCAGGACGGGAAGG - Intergenic
1075650818 10:124127647-124127669 GGGTCAGAACTGGGAGTGGAGGG - Intergenic
1076193398 10:128498530-128498552 GACCCAGCAAAGGGAGTGGAAGG + Intergenic
1076585984 10:131547955-131547977 GGCTCAGCACAGGCAGTGGGTGG - Intergenic
1077615340 11:3670003-3670025 GCCCCAGCCCTGGGAGTGGAGGG - Intronic
1079196916 11:18336600-18336622 GGAGCAGAACCGGGATTGGAAGG + Intronic
1080411721 11:32031233-32031255 AGAACAGCACCGGGAGTGAATGG - Intronic
1080502135 11:32880889-32880911 GTCTCAGCATCTGGAGTAGATGG - Intergenic
1081638240 11:44735010-44735032 GGCTGGACACGGGGAGTGGAGGG + Intronic
1081966158 11:47171399-47171421 GGCTCAGCTCCGGGTGTGGCAGG - Intronic
1083594412 11:63912074-63912096 GCCTCAGCAGCGGGGGTGGCTGG + Exonic
1083858307 11:65404802-65404824 GGCTCAGCAACAGGCATGGAAGG + Intronic
1083903871 11:65657587-65657609 GGCCCAGCACCTGGAAGGGAAGG - Intronic
1084593071 11:70101729-70101751 CGCTCTGCACCCGGAGGGGATGG + Intronic
1084596757 11:70121118-70121140 AGCTCTGCACCGGGGGAGGAGGG - Intronic
1086015915 11:82167327-82167349 GTTTCAGCACAGGGAGGGGAAGG + Intergenic
1088425545 11:109697273-109697295 TGCTCAGCCCCGGGAGTGCTGGG - Intergenic
1088805298 11:113347005-113347027 GACTCAGCACCTAGAGAGGACGG - Intronic
1090251107 11:125252562-125252584 GGCTCAGAAGGGGGAGTGGTGGG + Intronic
1090653196 11:128824536-128824558 GGCTCAGCCCTGGGGGTGGGGGG + Intergenic
1090665590 11:128913087-128913109 GTCTCATCACTGGGAGAGGAGGG + Intronic
1091741490 12:2963132-2963154 GGCTCATCAAGGGGAGAGGAGGG - Intronic
1095587175 12:43862281-43862303 GCCTCAGCCACGGGAGTAGATGG + Intronic
1099690467 12:85945262-85945284 GCCTCAGCATCTGGAGTGGCTGG - Intergenic
1100481220 12:94981331-94981353 GCCTCAGCACCCGGAGTAGCTGG - Intronic
1102259381 12:111435158-111435180 TGCTCTGCACCGGGTGTGGGTGG - Intronic
1103594324 12:122014491-122014513 GGAACAGCAGCAGGAGTGGATGG + Intergenic
1104774283 12:131382833-131382855 GGCTCAGCACCAGGAGGGAGCGG - Intergenic
1105996131 13:25673836-25673858 GGCTCTGCACAGGGAAAGGAGGG + Intronic
1108944823 13:56009157-56009179 GCCTCAGCATCTGGAGTGGATGG + Intergenic
1108991158 13:56659391-56659413 GGCTCTGCACTTGGAGTGGCCGG - Intergenic
1109936530 13:69292976-69292998 GGCTCAGCCCTGGGGGAGGAAGG + Intergenic
1112112714 13:96320706-96320728 GGCCCAGCAGCTGGTGTGGAGGG + Intronic
1113104411 13:106757752-106757774 GCCTCAGCTCCGGGAGGGGTGGG + Intergenic
1113741056 13:112712616-112712638 GGCTCTGCGCAGGGAGTCGAGGG - Intronic
1113956307 13:114101442-114101464 GGCCCAGCACGGGCAGTGGCTGG - Intronic
1114587440 14:23827202-23827224 GGCTGAGGACTGGGAGTGGCTGG - Intergenic
1115935406 14:38546769-38546791 GCCTCAGCCCCCGGAGTAGATGG - Intergenic
1117388264 14:55238342-55238364 GGCTCAGCCCCGCGAGTAGCTGG + Intergenic
1119642346 14:76324697-76324719 GGCTCAGCAAAGGCAGAGGAAGG + Intronic
1120814526 14:88841078-88841100 GGCCCAGCACGCAGAGTGGAAGG + Exonic
1122604641 14:102940015-102940037 TCCTCTGCACCGGGAGTGGAGGG - Intronic
1122919213 14:104873192-104873214 GGCTCAGTCCTGGGAGTGGGCGG + Intronic
1122977819 14:105178206-105178228 GGGCCGGCACCAGGAGTGGATGG + Intronic
1124166146 15:27327646-27327668 CGCCCAGCACAGGGACTGGATGG + Intronic
1128552891 15:68609631-68609653 GGCTCAGGCCTGGCAGTGGAAGG - Intronic
1129258074 15:74345482-74345504 CCCTCAGCAGAGGGAGTGGAGGG - Intronic
1132097693 15:99000128-99000150 GGCCCCGCACTGGGAGTGGCCGG + Intronic
1132671729 16:1104725-1104747 GGCTCAGCCCCGGGAGCTCAGGG + Intergenic
1133295353 16:4749180-4749202 GGCACAGGCCCCGGAGTGGAGGG - Exonic
1133935473 16:10265590-10265612 GCCTCAGCATCGTGAGTAGATGG - Intergenic
1135050157 16:19185948-19185970 GGCTCAGCATCAGGAGTGAACGG - Intronic
1137456631 16:48622836-48622858 CGCGCAGCACCAGGAGCGGAGGG - Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1142688613 17:1591792-1591814 GGCTCAGCACAGGGACAGCAGGG - Intronic
1143135277 17:4709323-4709345 GGCTCCGCACTCGGAGTGGCCGG - Intergenic
1145012432 17:19377623-19377645 GGCTCAGTGCCGGGAGGCGAAGG - Intronic
1145605440 17:25494109-25494131 GGTTCAGCACTGTGAGTTGAAGG - Intergenic
1146005085 17:29155849-29155871 GGCTCAGGAGAGGGAGTGGGAGG - Intronic
1148572129 17:48678554-48678576 GGCCCAGCTCCGGGAGTGCTGGG - Intergenic
1150014811 17:61543645-61543667 GGCTCAGCCTCTGGAGTAGATGG + Intergenic
1151194581 17:72422600-72422622 GGCTGAGCCCCGGGTGTGGTGGG + Intergenic
1151869492 17:76826842-76826864 GGTGGAGCACCGGAAGTGGAAGG + Intergenic
1152671297 17:81608863-81608885 GGCTCAGCGCCTGGAGTGACCGG - Intronic
1153761259 18:8334482-8334504 GGCTCAGCACAGGGAGAGCCTGG - Intronic
1154973166 18:21430709-21430731 GCCTCAGCCTCGGGAGTAGATGG + Intronic
1155383454 18:25250051-25250073 GCCTCAGCATCGGGAGTAGCTGG + Intronic
1156927237 18:42596831-42596853 TGCTCAGCCCCGGGAGGAGATGG + Intergenic
1160562839 18:79770469-79770491 GGCCCAGCACGGGGAGGGGGTGG + Intergenic
1160899266 19:1419065-1419087 GGCCCAGCCCCGGCAGTGGAAGG - Intronic
1161794862 19:6380819-6380841 GGCTCAGGACAGAGAGGGGATGG - Intronic
1162486659 19:10964730-10964752 GCCTCAGCCTCTGGAGTGGATGG + Intronic
1163007484 19:14406002-14406024 GACTGAGCCCCGGGAGTGGGCGG - Intronic
1164987496 19:32659194-32659216 GGCTCAGCCTCGGGAGTAGCTGG + Intronic
1165778104 19:38416858-38416880 GGATCAGCACCATGAGTGGATGG + Intronic
1166255218 19:41599417-41599439 GGCTTAGCACAGAGAGAGGAAGG + Intronic
1166283607 19:41810524-41810546 GGGTCAGCACAGGGCGTGGGTGG - Intronic
1166448636 19:42879666-42879688 GGCTCAGCACAGAAAGAGGAAGG - Exonic
1167631974 19:50630998-50631020 GGCTCAGCTCTGGGTGTAGAAGG - Intronic
1168277695 19:55286328-55286350 GGCTCAGGTCCTGGAGTCGAGGG + Intronic
1168400425 19:56083085-56083107 GCCTCAGCCCCCCGAGTGGATGG + Intergenic
925182177 2:1824466-1824488 GGCTGAGCACAGGGAGGAGAGGG + Intronic
925766711 2:7243596-7243618 GGCTCAGCCCCTTGAGTAGATGG + Intergenic
930095189 2:47561223-47561245 GGCTCTGCTCCGGGTGTGGGGGG + Intronic
932341537 2:70965311-70965333 TCCGCAGCACCGGGAGTCGAGGG - Exonic
933351905 2:81163686-81163708 GGGACAGCAAGGGGAGTGGATGG + Intergenic
937863309 2:126730198-126730220 GGATCAGCACAGGCAGTGCAGGG + Intergenic
938492834 2:131774984-131775006 GGGGCAGCACCAGGAGGGGAGGG - Intergenic
942322724 2:174750073-174750095 GGCACAGCACTGGACGTGGAGGG + Exonic
944217122 2:197267747-197267769 GACAAAGCACCAGGAGTGGAGGG + Intronic
947896833 2:233682189-233682211 GGATCAGGACCGGGAGTTCATGG + Exonic
948948034 2:241231267-241231289 GCCTCAGCCCCGGGAGTAGCTGG - Intronic
949007427 2:241657700-241657722 GGACCAGCACAGGGAGTGAAAGG - Intronic
1168964784 20:1892795-1892817 GGCCCAGCACAAGGAGGGGAAGG - Intergenic
1169244478 20:4015200-4015222 GGCGCGGCCCCGGGACTGGAGGG - Intronic
1169296402 20:4403607-4403629 GGCTCAGGACCTGCAGCGGATGG + Intergenic
1170661344 20:18343480-18343502 GGCTCAGCCCCCGGAGTAGCTGG - Intergenic
1170715995 20:18831538-18831560 GGCTCAGCGATGGGGGTGGATGG - Intergenic
1171013593 20:21521813-21521835 GCCGCAGCTCCGGGAGTAGAAGG - Intergenic
1171432215 20:25090278-25090300 GGCTTAGCTCAGGGACTGGATGG - Intergenic
1171432416 20:25091386-25091408 GGCTCTGCACCAGGAGTGTGCGG - Intergenic
1171897574 20:30823255-30823277 GACTCAGCAGCGTGAGGGGATGG - Intergenic
1172980759 20:38939830-38939852 GGCTTAGCACAGGGAGGGCAAGG - Intronic
1173378416 20:42511997-42512019 GGCTCAGCTCAGGGAGAGGGAGG - Intronic
1173644741 20:44626387-44626409 GGCTCAGCTCTGAGACTGGAAGG - Intronic
1173650877 20:44663289-44663311 GGCTCAGCATGGAGAGAGGAGGG + Intergenic
1174564180 20:51452791-51452813 GGCTTAGCACCGGAAGTGCTCGG - Intronic
1175297385 20:57918362-57918384 GGCTCTGCATCAGGAATGGAAGG - Intergenic
1178537120 21:33419828-33419850 GGCTGAGCCCCGGCAGTGGCAGG + Intronic
1178838146 21:36115648-36115670 GCCTCAGCCCCGGGAGTAGCTGG + Intergenic
1179887640 21:44321192-44321214 GCCTCAGCACGGTGGGTGGAGGG + Intronic
1180348627 22:11777872-11777894 GCCTCAGCATCCGGAGTGGCTGG - Intergenic
1180372914 22:12061326-12061348 GCCTCAGCATCCGGAGTGGCTGG - Intergenic
1181042974 22:20201588-20201610 GGCTGAGGACTGGGGGTGGATGG + Intergenic
1183606873 22:38871408-38871430 GGCACAGCACGGGGCCTGGAAGG - Intronic
1184240158 22:43207623-43207645 GGGTCAGCAGGGGGAGAGGAAGG + Intronic
1184377870 22:44125890-44125912 AGCTCAGCCCCCAGAGTGGAAGG + Intronic
1185138674 22:49088360-49088382 GGCTGGGCCCCGAGAGTGGACGG + Intergenic
1185207890 22:49550621-49550643 GGCTGAGCACTGGGAGAGGACGG - Intronic
1185233257 22:49695174-49695196 GCCACAGAACCGGGCGTGGAGGG + Intergenic
1185364885 22:50432916-50432938 GGCTCAGCACCCCAAGGGGAGGG - Intronic
950799543 3:15539095-15539117 GGGTCATCTCAGGGAGTGGATGG + Intergenic
953027239 3:39152372-39152394 GGCTCAGCACCGGGAGTGGAGGG + Intronic
953158701 3:40398364-40398386 GGTTCAGCACCAGGCGTGGCAGG + Intronic
954303856 3:49715311-49715333 TGCTCTGGACCTGGAGTGGATGG + Intronic
954320489 3:49829306-49829328 GGCTCAGAGCCGGGGGTGGGCGG + Intronic
954684598 3:52363544-52363566 GGCTCAGCAAGCTGAGTGGAAGG - Intronic
955693093 3:61608963-61608985 GGCTCAGCATGAGGAGTGGCAGG + Intronic
963236289 3:142960517-142960539 GGCTCAGCAGGAGGAGTGGGTGG - Intronic
967983216 3:195077861-195077883 GGCTGGGCACGGGGAGCGGAGGG - Intronic
968052139 3:195662429-195662451 GGCTCAGCCCCAGGACAGGATGG + Intergenic
968103673 3:195985909-195985931 GGCTCAGCCCCAGGACAGGATGG - Intergenic
968301974 3:197623502-197623524 GGCTCAGCCCCAGGACAGGATGG - Intergenic
968772432 4:2516238-2516260 GAGTCAGCACTGGGAGTGCATGG + Intronic
971563547 4:28112859-28112881 GGCGCCGCACTGGGAGTGGCTGG + Intergenic
976950452 4:90822611-90822633 GTCTCAGCCTCGGGAGTGGCTGG - Intronic
978765648 4:112402353-112402375 TGCTCAGCATCGGGAGGGGCTGG + Intronic
985498348 5:224218-224240 GGCTCAGCCCCAGGACAGGATGG + Intronic
985647297 5:1090975-1090997 GGCTCGGCCCCTGGGGTGGAAGG - Intronic
986061082 5:4191867-4191889 GGGGCAGCACGGGGAGGGGAGGG + Intergenic
986213936 5:5700150-5700172 GTCTCAGCATCTGGAGTGGGAGG - Intergenic
986861522 5:11931910-11931932 GGCTCAGCCCCCTGAGTGGGAGG + Intergenic
993376746 5:87157599-87157621 GCCTCAGCACCCCGAGTGGCTGG + Intergenic
993378909 5:87183204-87183226 GGATCATCAGCTGGAGTGGAAGG + Intergenic
995319957 5:110823471-110823493 GGCTCAGAATGGGGAGTGCATGG - Intergenic
997656333 5:135557573-135557595 GTCTGAGCACTGGGAATGGAGGG - Intergenic
998557925 5:143143720-143143742 GGCTAGGCACCAGGAATGGATGG + Intronic
999718108 5:154378491-154378513 AGCTCAGAAGTGGGAGTGGAAGG - Intronic
1002133580 5:177095514-177095536 GGCCCTGCAGAGGGAGTGGAGGG - Exonic
1002514803 5:179749745-179749767 GGCTCTGCACCAGACGTGGAGGG + Intronic
1004165143 6:13250222-13250244 GGATCAGCACTGTGAGAGGAAGG - Intronic
1006116167 6:31777188-31777210 GGCTCAGCAGAGGGGGAGGAAGG + Exonic
1006188668 6:32194742-32194764 GGCTCAGCATTTGGATTGGATGG - Intronic
1006641994 6:35494442-35494464 GGCACAACACCAGGAGGGGAGGG + Intronic
1007417763 6:41702120-41702142 GGCGCAGGACTGGGAGTGCAGGG - Intronic
1010277962 6:73990910-73990932 GGCCCAGCACTGGGAGCGGCTGG - Intergenic
1018859919 6:167704053-167704075 GACTCAGCCCTGGGAGGGGAGGG + Intergenic
1019323658 7:426752-426774 AGCACAGCACGGGGAGTGGCAGG - Intergenic
1019484555 7:1283521-1283543 GGCCCAGCAGGGAGAGTGGAGGG + Intergenic
1019598278 7:1868518-1868540 GGCTCAGCAGGGGGTGGGGAAGG + Intronic
1021740550 7:23681218-23681240 GGCTCTGCTCTGGGAGAGGACGG - Intronic
1023836659 7:44072605-44072627 GGCTCTGCGACGGGAGTGGCAGG + Exonic
1023942895 7:44781382-44781404 GGCACAGCACCAGGAGAGGTTGG + Intergenic
1028912971 7:96228787-96228809 GGCCCTGCACTCGGAGTGGATGG + Intronic
1029128506 7:98312359-98312381 GGCTTAGCACCAGGAGTGTGGGG + Intronic
1033473484 7:141669046-141669068 GGCTGGGCCCCGGGAGTGGAGGG - Intronic
1034467438 7:151238301-151238323 GGGTCAGCACCAGGAGGGGAGGG - Exonic
1034981674 7:155482989-155483011 GTCTCAGCCCTGGGAGTGCAGGG + Intronic
1037109278 8:15146487-15146509 GCCTCAGCCCCGTGAGTAGATGG + Intronic
1041319557 8:56599268-56599290 GGCCCATCACCAGGTGTGGATGG - Intergenic
1044746829 8:95378720-95378742 GGCTCAGCCACTGGAGTGGCTGG + Intergenic
1044746857 8:95378952-95378974 GGCTCAGCCACTGGAGTGGCTGG + Intergenic
1045678430 8:104633165-104633187 GGCCCAGCACTGGGAGCGGCCGG - Intronic
1046944612 8:119962960-119962982 GGCACAGGACCGGGTTTGGAAGG + Intronic
1049248508 8:141575781-141575803 GGATCAGCACTGGGAGGGGCAGG - Intergenic
1049337059 8:142092216-142092238 GGCTCAGCACTGAGAGAGCAGGG - Intergenic
1055651353 9:78410077-78410099 GGCCCCGCACTGGGAGTGGCCGG + Intergenic
1057195394 9:93113562-93113584 GGCTCAGCAGCTGGGGTGGGGGG - Intergenic
1058504827 9:105656485-105656507 GGCTCAGCTCCGGGGGTGCTAGG + Intergenic
1060206783 9:121686921-121686943 GGCTCAGCCCTGGCAGTAGAAGG + Intronic
1061449341 9:130660116-130660138 AGCGCAGCACCGGCAGGGGAGGG + Intergenic
1061956109 9:133962066-133962088 GGCTCAGCACTGGGGGTGGAGGG + Intronic
1062339767 9:136088769-136088791 GGCTCAGGCCTGGGCGTGGAGGG + Intronic
1062586150 9:137250944-137250966 GCCTCAGCAGAGGGGGTGGAGGG - Intergenic
1062621149 9:137423138-137423160 GGTTCCGCGCCGGGCGTGGACGG - Exonic
1185522497 X:751985-752007 CACACAGCACCTGGAGTGGACGG - Intergenic
1186496299 X:10015070-10015092 GGCGGAGCAGCGGGAGTGGGTGG + Intergenic
1189369642 X:40417437-40417459 GCCTCAGCACCCTGAGTAGATGG + Intergenic
1189615006 X:42774195-42774217 GCCTCAGCCCCTGGAGTGGCTGG - Intergenic
1191258576 X:58290577-58290599 GCCTCTGCGCCGGGACTGGAGGG + Intergenic
1195399690 X:104448036-104448058 TGCTAAGCAGCAGGAGTGGACGG - Intergenic
1197882061 X:131177381-131177403 GGCTAAGGATCGGGTGTGGAGGG + Intergenic
1198022281 X:132670891-132670913 GGCTCTGCTGCTGGAGTGGATGG + Intronic
1198402974 X:136285401-136285423 GGCTCAGCCTCGGGAGTAGCTGG - Intergenic
1198637003 X:138711747-138711769 GGCTCAGCCCCGGGAGGGAGGGG - Intronic
1199980866 X:152919751-152919773 GGCTGAGCCCAGGGAGGGGAGGG - Intronic
1201487051 Y:14505730-14505752 GGCCCAGCACTGGCAGTGGCCGG + Intergenic