ID: 953032078

View in Genome Browser
Species Human (GRCh38)
Location 3:39185832-39185854
Sequence GGCTGCACACAGATGGCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953032078_953032094 17 Left 953032078 3:39185832-39185854 CCCCAGGCCATCTGTGTGCAGCC 0: 1
1: 1
2: 2
3: 39
4: 269
Right 953032094 3:39185872-39185894 CTGGCCCAGTACTCTGACCTGGG 0: 1
1: 0
2: 2
3: 22
4: 199
953032078_953032084 -2 Left 953032078 3:39185832-39185854 CCCCAGGCCATCTGTGTGCAGCC 0: 1
1: 1
2: 2
3: 39
4: 269
Right 953032084 3:39185853-39185875 CCCCCAGGCTCCTCCCGCCCTGG 0: 1
1: 0
2: 6
3: 81
4: 628
953032078_953032097 26 Left 953032078 3:39185832-39185854 CCCCAGGCCATCTGTGTGCAGCC 0: 1
1: 1
2: 2
3: 39
4: 269
Right 953032097 3:39185881-39185903 TACTCTGACCTGGGCCTCCCTGG 0: 1
1: 1
2: 1
3: 57
4: 1144
953032078_953032093 16 Left 953032078 3:39185832-39185854 CCCCAGGCCATCTGTGTGCAGCC 0: 1
1: 1
2: 2
3: 39
4: 269
Right 953032093 3:39185871-39185893 CCTGGCCCAGTACTCTGACCTGG 0: 1
1: 0
2: 0
3: 21
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953032078 Original CRISPR GGCTGCACACAGATGGCCTG GGG (reversed) Exonic
900242892 1:1625361-1625383 TGCTGGACACTGATGTCCTGCGG + Exonic
900356281 1:2266341-2266363 AGCACCACACAGAGGGCCTGGGG - Intronic
900747017 1:4367413-4367435 GGCTGTTAACAGATGGCCAGGGG + Intergenic
900780926 1:4616794-4616816 GGATGCTCACAGCTGGTCTGTGG + Intergenic
901225735 1:7611966-7611988 GGGTGCACAGAGATGGGCAGGGG + Intronic
901424029 1:9169775-9169797 GGCTGGCCCCAGAAGGCCTGGGG - Intergenic
902386523 1:16079040-16079062 GGCTGCCCCCTGATGGCCAGCGG - Intergenic
903152704 1:21423475-21423497 CTCTGCCCACAGATGGGCTGAGG + Intergenic
903160425 1:21484510-21484532 CTCTGCCCACAGATGGGCTGAGG - Exonic
903237040 1:21956846-21956868 GGCTGGACACAGATGCCCTTCGG - Intergenic
903414148 1:23169828-23169850 GCCAGGACACAGATGGGCTGAGG + Intronic
903673563 1:25050838-25050860 GGCTGGACACACAGGGCCTTGGG - Intergenic
903833653 1:26189373-26189395 AGCTGTACTCAGAGGGCCTGGGG + Exonic
903963193 1:27070253-27070275 GGATGGACACAGATGACCTGAGG - Intergenic
905212698 1:36385606-36385628 TGCTGCACTCAGATGGCTTCAGG + Intronic
905872578 1:41413526-41413548 GCCTGCTCTCAGCTGGCCTGGGG - Intergenic
905923517 1:41734126-41734148 GGCTGCACCCACCAGGCCTGGGG + Intronic
908255470 1:62299950-62299972 GGCTGCACACACATGCCGAGGGG - Intronic
908605312 1:65792271-65792293 GGCTGCACAAAGAGGGACTGGGG - Intergenic
908782048 1:67699850-67699872 GGCTCCACAAAGATGGTCAGAGG + Intergenic
909974585 1:82030100-82030122 AGCTCCACACAGATTGTCTGAGG - Intergenic
911290043 1:96046337-96046359 TGCTGCACAAAGGTGGCCTGGGG + Intergenic
914352584 1:146853375-146853397 GGCTCCACAGAGAAGGGCTGTGG - Intergenic
914490627 1:148148454-148148476 GGCCGCACACCAATGACCTGGGG + Intronic
915274842 1:154781320-154781342 TGCCACACACAGATGGCCAGAGG - Intronic
915553557 1:156648655-156648677 GGCTGCATACAGTTGGCCCGTGG - Exonic
915894130 1:159798109-159798131 GGCCCCACACAGATGATCTGAGG + Intergenic
917245529 1:172996785-172996807 GGCTGCACACAGCAGGTATGGGG - Intergenic
921389907 1:214606762-214606784 GGCTGCACACCAGTGACCTGGGG - Intronic
921959795 1:221022608-221022630 CTCTTCACACAGATGCCCTGAGG + Intergenic
922090841 1:222393635-222393657 GGCCTCACACCCATGGCCTGAGG + Intergenic
922480595 1:225937845-225937867 GGCTGAAGTCAGAAGGCCTGGGG + Intronic
1062784969 10:256717-256739 GTGAGCACACAGATCGCCTGAGG + Intergenic
1062884301 10:1004759-1004781 AGCTGCTCACAGCTGGCTTGGGG + Intronic
1062970084 10:1640909-1640931 GGCTGGACAAAGCTGCCCTGTGG + Intronic
1065447051 10:25813639-25813661 GGCTGTACACAGCAAGCCTGTGG - Intergenic
1065962319 10:30743727-30743749 GCATGCACACAGATAGACTGTGG + Intergenic
1067318971 10:45199230-45199252 GGCTGGGCCCAGAGGGCCTGAGG + Intergenic
1067319644 10:45205681-45205703 GGCTGGACCCAGAAGGCCAGAGG + Intergenic
1069566721 10:69468274-69468296 GGCTGCCCACAGCCTGCCTGGGG + Intronic
1070409615 10:76127714-76127736 GTCTGCACTCAGATTGCCTTAGG + Intronic
1070832954 10:79431449-79431471 GGGGGCACACAGATCACCTGGGG + Intronic
1071320541 10:84451521-84451543 AGCAGAACACAGATGGCTTGAGG + Intronic
1072307526 10:94121820-94121842 GTCTGCCTAAAGATGGCCTGAGG - Intronic
1072462772 10:95635355-95635377 AGCTTCACAAACATGGCCTGGGG + Intronic
1072570564 10:96654486-96654508 GGCTGCACACACATGTGCTGTGG + Intronic
1073462903 10:103676779-103676801 CTCTGCACACAAATGCCCTGGGG - Intronic
1073857920 10:107698668-107698690 GCTTGCACACATATTGCCTGCGG - Intergenic
1075647013 10:124103313-124103335 GGTTGCAAAGTGATGGCCTGTGG - Intergenic
1076606024 10:131690616-131690638 GCGGGCACACAGAAGGCCTGTGG - Intergenic
1077331526 11:1985922-1985944 TGCTGCACACAGCTGGCCACGGG + Intergenic
1077441834 11:2572453-2572475 GGCTGCACTCAGATGGGTTCAGG + Intronic
1078431167 11:11289906-11289928 GGCTGAACACAGAAAGGCTGAGG + Intronic
1079812091 11:25008202-25008224 GGCTGAACACAGAGTCCCTGTGG - Intronic
1083611332 11:64005819-64005841 GGCTGGAGACAGAGGGCCTTGGG + Intronic
1084129190 11:67119769-67119791 GGCTGCTGACCGCTGGCCTGGGG + Exonic
1084509246 11:69593057-69593079 TGCTGCACGCAGAGGGCCAGAGG + Intergenic
1084593769 11:70105269-70105291 GGCTGCATAGGGATGGCCCGAGG - Intronic
1084919803 11:72459829-72459851 GCCTGCAGACAGAGGGACTGTGG + Intergenic
1089740468 11:120578724-120578746 GGTTGCACCCAGCTGGCCAGTGG + Intronic
1090084260 11:123637319-123637341 GGCAGTGCCCAGATGGCCTGAGG + Intronic
1090920105 11:131199329-131199351 GGCTGCACCCAGATCTCCTGAGG + Intergenic
1202814507 11_KI270721v1_random:41098-41120 TGCTGCACACAGCTGGCCACGGG + Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093848731 12:24009693-24009715 GGAAGCTTACAGATGGCCTGTGG + Intergenic
1094061458 12:26318854-26318876 TTCTGCACACAGCTGCCCTGGGG + Intergenic
1094066408 12:26365187-26365209 GCCTGAACACAGAGGACCTGAGG + Intronic
1101251467 12:102939858-102939880 GGCTGCACACTGCAGCCCTGGGG - Intronic
1103376784 12:120462771-120462793 GGCTGAAGGCAGAGGGCCTGGGG - Exonic
1104679472 12:130739613-130739635 GGCTGCCAACTGCTGGCCTGAGG - Intergenic
1104980355 12:132570713-132570735 CCCCGCACACAGATGGCCTGTGG - Intronic
1104990281 12:132620625-132620647 ACCTGCACAGAGAGGGCCTGGGG + Intronic
1105240038 13:18600171-18600193 GGCTGGCCCCAGACGGCCTGAGG + Intergenic
1105601160 13:21888672-21888694 GTTTGCACACCGATGGCCTTAGG + Intergenic
1105826844 13:24130250-24130272 GGCTTCACACACACGGCCAGTGG + Intronic
1106391718 13:29340171-29340193 GGCAGCACCCAGATGATCTGGGG + Intronic
1107791204 13:44004151-44004173 GGCTGAACACATATGGGATGTGG - Intergenic
1112555606 13:100465752-100465774 GGCTGCACACAGCTTGGTTGGGG + Intronic
1114443560 14:22770522-22770544 GCCTGCAGACAGGTGGCCTCTGG + Exonic
1115369374 14:32594669-32594691 GCCTGGGCAGAGATGGCCTGAGG + Intronic
1115885825 14:37970691-37970713 GGCTGCACACAGAGGTTATGAGG - Intronic
1117996513 14:61483126-61483148 GGATGGCCACTGATGGCCTGAGG - Intronic
1120891892 14:89498778-89498800 GGCTGCACACAGAGGGCGGGGGG + Intronic
1120891904 14:89498814-89498836 GGCTGCACACAGAGGGTGGGGGG + Intronic
1121867521 14:97376847-97376869 GGCTGGTGACAGGTGGCCTGGGG + Intergenic
1122620785 14:103056814-103056836 GGCTGGAGAGAGATGGGCTGCGG + Intronic
1122910664 14:104826396-104826418 GGCTGGCCACGGGTGGCCTGAGG - Intergenic
1123491196 15:20783896-20783918 GGCTGGCCCCAGACGGCCTGAGG - Intergenic
1123547698 15:21352987-21353009 GGCTGGCCCCAGACGGCCTGAGG - Intergenic
1125185570 15:36925911-36925933 TTCTGCTCACAGATTGCCTGAGG + Intronic
1126695917 15:51325266-51325288 AGCTGAAGACAGATGTCCTGTGG + Intronic
1128344871 15:66847544-66847566 TGCTGCACACACCAGGCCTGGGG - Intergenic
1128745269 15:70110064-70110086 GGCTGCAGGCAGGTGGGCTGGGG - Intergenic
1130015875 15:80186029-80186051 GTCAGCACACAGCTGGCCCGAGG - Intronic
1132392718 15:101450656-101450678 AGCTGGACACAGATGGGATGGGG - Intronic
1202956028 15_KI270727v1_random:80217-80239 GGCTGGCCCCAGACGGCCTGAGG - Intergenic
1132691077 16:1182225-1182247 GGCTGCACCCAGGTGGGCTGAGG - Intronic
1133774891 16:8888516-8888538 GTCTGCATCCAGAAGGCCTGGGG - Intergenic
1135148958 16:19988643-19988665 GGCTACACACAGCTGCCCTTAGG + Intergenic
1135501548 16:23000247-23000269 GGCTCCACACAGCTGGCTGGTGG + Intergenic
1135808450 16:25565708-25565730 AGTTGCATTCAGATGGCCTGGGG - Intergenic
1136233746 16:28902574-28902596 GGCTGCACCCACATAGCCTGTGG - Exonic
1137063437 16:35812369-35812391 AGGTTCACACAGATGCCCTGAGG - Intergenic
1137624160 16:49897068-49897090 GGCTGCACCCAGATGGATGGGGG - Intergenic
1138247254 16:55477248-55477270 GGCTGCAAACTCGTGGCCTGTGG - Intronic
1138578274 16:57922807-57922829 AGCTGCAGACAGTAGGCCTGGGG - Intronic
1139061832 16:63262880-63262902 GGCTGCACACAGCAGCCCTGGGG + Intergenic
1139426788 16:66885507-66885529 TGCTGGCCTCAGATGGCCTGTGG + Exonic
1139981445 16:70862144-70862166 GGCTCCACAGAGAAGGGCTGTGG + Exonic
1141461337 16:84180220-84180242 GGCTGCACGCAGCTGGGCCGGGG + Exonic
1141648856 16:85381934-85381956 GCCTGCTCACAGAGTGCCTGAGG + Intergenic
1142261604 16:89045053-89045075 TGCTTCACACGGCTGGCCTGAGG - Intergenic
1142405144 16:89884356-89884378 GGCTGGACACAGAAGGCCCTGGG + Intronic
1143290628 17:5825288-5825310 GATTGCACATAGATGCCCTGAGG + Intronic
1143343690 17:6233897-6233919 GACTGCCCACAGCTGTCCTGGGG - Intergenic
1143610089 17:8013097-8013119 GGCTGTCCACAGCTGGTCTGGGG - Exonic
1143618812 17:8069477-8069499 GGGTGAGCACAGAGGGCCTGGGG + Intergenic
1145980391 17:29007689-29007711 GGCAGCAGGCAGATGGCGTGTGG + Intronic
1147399002 17:40167903-40167925 GGCTGCACAAGCATGCCCTGTGG - Exonic
1147399964 17:40174809-40174831 AGCAGCAGACAGATAGCCTGAGG + Intergenic
1147978794 17:44262349-44262371 GGATGGGCACAGATGGCATGTGG + Intronic
1148816297 17:50330374-50330396 GGCTGCAGACGGAGGGGCTGAGG - Intergenic
1151619499 17:75237326-75237348 GGCTGGACACAGGAGGCCTCAGG - Exonic
1152603594 17:81277831-81277853 GGCTGCACACAGATGCTCCATGG - Intronic
1152740270 17:82015652-82015674 GGCTGCTCACAGAAGCCCAGGGG - Intronic
1152784121 17:82239223-82239245 TGCTGCTCCCAGGTGGCCTGCGG + Exonic
1152888869 17:82868395-82868417 CGCTGCACACAGAGGCCCGGGGG - Intronic
1153006819 18:504494-504516 GGCTCCACACTGAGGACCTGTGG - Intergenic
1154113742 18:11592844-11592866 TGCAGCACAAAGATAGCCTGTGG - Intergenic
1154338923 18:13487560-13487582 TAATGCACACAGAAGGCCTGCGG - Intronic
1154448794 18:14458603-14458625 GGCTGGCCCCAGACGGCCTGAGG - Intergenic
1157113593 18:44843228-44843250 GGCCTCACACTGAGGGCCTGAGG + Intronic
1158874656 18:61721668-61721690 GGCAGCACACAGTTGTACTGGGG + Intergenic
1160491220 18:79337815-79337837 GGCTGCAGACATCTGGCCGGCGG - Intronic
1160980575 19:1814896-1814918 GACTGCACACAGATGGTGAGAGG - Intergenic
1160994991 19:1878372-1878394 GGCCGCACACCAATGACCTGGGG - Intronic
1162345176 19:10114544-10114566 GGGTGGACACAGAAGGCCAGGGG - Exonic
1162348256 19:10134001-10134023 TGCTGCACACAGCAGGCCTTTGG - Intronic
1162842054 19:13363840-13363862 GTCTGCACCCAGATGGCCAGTGG + Intronic
1163677980 19:18664973-18664995 GGAGGGACAGAGATGGCCTGTGG + Intronic
1163782544 19:19257981-19258003 GGCTGCGCACACCAGGCCTGCGG + Exonic
1165370351 19:35401768-35401790 TGCTGCAGACAGAAGGCCCGTGG + Intergenic
1165752074 19:38266248-38266270 GGCTGCAGCCAGATGGCCTAGGG + Intronic
1166330657 19:42076359-42076381 GCCTGCGCACTGAGGGCCTGAGG + Intronic
1166972968 19:46582732-46582754 TGCTGGCCACAGAGGGCCTGAGG - Intronic
1167013521 19:46824541-46824563 GGTTGCAAACACATGGCCTGAGG + Intergenic
1167615310 19:50529886-50529908 GGTTACACTGAGATGGCCTGGGG + Intronic
1167735615 19:51292928-51292950 GGCTGCACACTGCTGGGTTGTGG - Intergenic
1168121019 19:54252548-54252570 GGCTGGACAGAGATGGACAGAGG + Exonic
925148211 2:1595055-1595077 GGCTGCACACAGCAGGCAGGAGG + Intergenic
925309938 2:2875216-2875238 GGCTGCACCCAGGCGGCCTGGGG - Intergenic
925461571 2:4067651-4067673 GCCAGCACCCACATGGCCTGTGG - Intergenic
926418313 2:12672890-12672912 GGCTGCACACCGCTCGGCTGTGG + Intergenic
927111019 2:19863818-19863840 GGCTGTCCACAGGCGGCCTGAGG - Intergenic
928418966 2:31122522-31122544 GATTGCACACAGATCACCTGGGG + Intronic
929091182 2:38218698-38218720 GGCAGCACAGAGAAGGTCTGGGG - Intergenic
929111334 2:38407558-38407580 GGCTGCTGACAGATGGTCTGTGG - Intergenic
934038752 2:88110348-88110370 GTCTGCACCCGCATGGCCTGTGG - Exonic
936269242 2:111036305-111036327 GGCCCCACACAAGTGGCCTGAGG + Intronic
937065043 2:119011494-119011516 GGCTCCACAAACATGACCTGGGG + Intergenic
938381524 2:130838869-130838891 GGCTGCCCAGAGATGTCCAGTGG - Intronic
938774995 2:134533851-134533873 TGCTGCAAACAAAGGGCCTGAGG - Intronic
938980494 2:136521702-136521724 GGGTGCAGACAGTCGGCCTGAGG - Intergenic
939562672 2:143751175-143751197 GGCTACCCACAGAAGGTCTGGGG + Intronic
940386995 2:153085443-153085465 GGCTGCACACAGCAGCCCTGGGG - Intergenic
946074360 2:217061741-217061763 TGCCCCACAGAGATGGCCTGTGG + Intergenic
946221396 2:218230756-218230778 GACTTCACACAGTTGGCTTGAGG + Intronic
946365367 2:219245667-219245689 GGCTGCCCAAAGATGGGCTGGGG + Intronic
948120142 2:235523689-235523711 GGCTGCACAGACATGGCGGGGGG + Intronic
948664964 2:239528995-239529017 ACCTGCACTCACATGGCCTGGGG - Intergenic
948809610 2:240467876-240467898 CGCTGCACACAGACGGCCTAGGG + Exonic
1168742081 20:200534-200556 GGTTCCACACTGATGGCCTTGGG - Intergenic
1169073842 20:2749856-2749878 GTCTGCACCCGGATGGCGTGGGG - Exonic
1169339094 20:4782580-4782602 GACTGCAGAAAGATGGCATGCGG - Exonic
1169570072 20:6896747-6896769 TGCTCTACACAGATGGGCTGGGG + Intergenic
1169973197 20:11293692-11293714 GTGTGCACACAGATCACCTGAGG + Intergenic
1170114856 20:12846463-12846485 GGATGCACATGGATGGCCCGGGG + Intergenic
1171235055 20:23517947-23517969 GTCTGAAAACAGTTGGCCTGTGG - Intergenic
1171373392 20:24675901-24675923 AGCTGCACACACATGGGCAGTGG + Intergenic
1172461016 20:35118754-35118776 GGCTGCACAGAGATGGCCTGGGG + Intronic
1172783649 20:37451821-37451843 GGGTGGCCACAGATGTCCTGGGG - Intergenic
1173530963 20:43769268-43769290 AGGTGCACACAGATGGCCAGAGG - Intergenic
1173671300 20:44800898-44800920 GGCAGCACACAGCTGGCGTCAGG - Intronic
1174257025 20:49264444-49264466 GGCTGTACACAGAGGTGCTGTGG + Intronic
1175735044 20:61379539-61379561 GGCTGCAGGGAGGTGGCCTGTGG + Intronic
1176447429 21:6831919-6831941 GGCTGGCCCCAGACGGCCTGAGG + Intergenic
1176825597 21:13696945-13696967 GGCTGGCCCCAGACGGCCTGAGG + Intergenic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1179274713 21:39881741-39881763 CTCTGCACCCAGATGGACTGAGG + Intronic
1179296368 21:40066240-40066262 AGCTGCACAAAGATTTCCTGAGG + Intronic
1179470241 21:41605525-41605547 GGCTGCTCACGCAAGGCCTGCGG + Intergenic
1180983123 22:19888689-19888711 GGCTTCACACACAGGCCCTGTGG + Intronic
1181148546 22:20866176-20866198 GCCTGCACACAGACGGCGAGGGG + Intronic
1181409202 22:22706372-22706394 GGCTTCACACATATGTCCTACGG - Intergenic
1181416614 22:22764223-22764245 GGCTTCACACATATGTCCTATGG - Intronic
1181859396 22:25806389-25806411 GGCTGGGCACAGCTGGCCTTTGG + Intronic
1182356217 22:29723314-29723336 GGCTGCACAGAGCTGGCCTGAGG + Intronic
1183336243 22:37248527-37248549 GGTTGAATACAGATGGCCTTAGG - Intergenic
1183505954 22:38208966-38208988 GGCTGGACACACAGGGCCTGGGG + Intronic
1184817420 22:46882527-46882549 GGCAGCACACACCTGGGCTGAGG + Intronic
1185287565 22:50009386-50009408 GGCTGCTCGCAGACAGCCTGTGG + Intronic
949165714 3:938402-938424 GGCTGCACATAGCAGCCCTGGGG - Intergenic
950575527 3:13830013-13830035 GGCTGCTTAAAGATGCCCTGGGG - Intronic
951835221 3:26975947-26975969 GGGTGCACAGAGGTGGCCTGAGG - Intergenic
953032078 3:39185832-39185854 GGCTGCACACAGATGGCCTGGGG - Exonic
953960624 3:47263341-47263363 GGCAGGACACAGGTGGCCTGGGG - Intronic
954866155 3:53731831-53731853 TGCTTCAGACAGAAGGCCTGAGG - Intronic
955134438 3:56202077-56202099 TGCTGTGCTCAGATGGCCTGCGG - Intronic
956882927 3:73529379-73529401 GGCTGCAAACAGGTGACCTGAGG + Intronic
961009257 3:123425030-123425052 GGCTGCACTCAGGATGCCTGGGG - Intronic
962738710 3:138348067-138348089 CGGTGCACCCAGAAGGCCTGCGG + Exonic
965688819 3:171333716-171333738 GGTTGCAAACTGATGGCCAGAGG - Intronic
967408116 3:189139733-189139755 CACTGCACACAGATGCCATGGGG - Intronic
967974539 3:195025765-195025787 GTCTGCATAAAGACGGCCTGGGG - Intergenic
967980121 3:195060665-195060687 GGCTGCTCACAGATCCCCTGTGG + Intergenic
968627194 4:1631289-1631311 TGCTGCCCACAGCAGGCCTGGGG - Intronic
968707927 4:2091935-2091957 GCCTGCACATAGTGGGCCTGTGG + Intronic
969251912 4:5973752-5973774 AGCTGCACAGACATGGGCTGGGG - Exonic
969325928 4:6443813-6443835 GGCTGCAAACAGATGGCTCCCGG + Intronic
969514707 4:7640592-7640614 GGGCCCACACAGATAGCCTGGGG + Intronic
969798370 4:9543448-9543470 GTCTGCACCCTGATGTCCTGGGG + Intergenic
969845694 4:9918443-9918465 GGCTGCCTAGGGATGGCCTGGGG + Intronic
970242070 4:14019945-14019967 CGCTCCACATAGAAGGCCTGGGG - Intergenic
970512513 4:16795252-16795274 GGCTGCAGAAAGAGAGCCTGTGG + Intronic
971629454 4:28971454-28971476 GGCTGTACACAGATGTCCTTGGG - Intergenic
973814998 4:54611370-54611392 GACTGAGCACAGATTGCCTGTGG + Intergenic
975498962 4:75063703-75063725 GGCAGAACACAGATAGCCTGAGG - Intergenic
980114965 4:128670498-128670520 TGCTACAGAGAGATGGCCTGGGG - Intergenic
981240180 4:142467315-142467337 GGCTGGACTCTCATGGCCTGAGG - Intronic
982321649 4:154083072-154083094 GACTGCAGTCAGAGGGCCTGCGG - Intergenic
986359336 5:6960894-6960916 GGCAACACACAGAAAGCCTGTGG + Intergenic
987143369 5:14967357-14967379 AGCTGCATACTGATGGTCTGTGG + Intergenic
988695115 5:33614109-33614131 GGCTCCACTGAGATGGCCAGGGG - Intronic
989268688 5:39506501-39506523 TGCTTCACACAGCTGTCCTGAGG - Intergenic
989505998 5:42228594-42228616 GGCTGCACACCGCAGCCCTGAGG + Intergenic
992096305 5:73366196-73366218 TGTTCCACACAGGTGGCCTGAGG + Intergenic
992597374 5:78360293-78360315 GGCTGGACGCAGCTGGCCTCCGG + Intergenic
997361657 5:133299144-133299166 GGCTGCTTACAGAGGGGCTGGGG + Intronic
997400857 5:133601088-133601110 GGCTGCTCACAGATTTGCTGGGG + Intronic
997622733 5:135309383-135309405 GGCTGCACAGAGATGGCCTTGGG + Intronic
997718870 5:136062359-136062381 GGCTGCACAGAGGTGGCCTCAGG - Intronic
999056817 5:148586956-148586978 GGCTGCACTCTGATGGCCCTGGG + Intronic
999541942 5:152584152-152584174 GGCTGCATACAGAAGCCCTGGGG + Intergenic
1000178036 5:158777508-158777530 GTCTGCACACGGATGGCATGAGG + Exonic
1001815782 5:174668336-174668358 GGTTGCAAACAGGTGGCCTGAGG - Intergenic
1002060846 5:176625098-176625120 GCCTGCACACACATGTCATGGGG + Intronic
1002419812 5:179139652-179139674 GGCTGCAGGCAGGTGGGCTGTGG + Intronic
1002579209 5:180197365-180197387 GGCTGGACAGAGAAGGCCTGGGG + Intronic
1003045569 6:2730098-2730120 TGCTGCAGGCAGATGGCCTGCGG - Intronic
1006694500 6:35920344-35920366 GGCTGCAGCCACATGGCCTCGGG - Intronic
1008658239 6:53638452-53638474 GGATGCACACAGACTGCCTTGGG + Intergenic
1013609803 6:111783923-111783945 GTGTGCACACAGATCACCTGGGG - Intronic
1015160186 6:130144141-130144163 AGCTGCACATTTATGGCCTGTGG - Intergenic
1016510424 6:144836572-144836594 GGCAGTGGACAGATGGCCTGGGG - Intronic
1018228578 6:161654657-161654679 AGGTGCACACAGTAGGCCTGAGG - Intronic
1018935265 6:168269851-168269873 GGCACAAAACAGATGGCCTGAGG - Intergenic
1022172584 7:27844071-27844093 GGCGGCAGCCAGAGGGCCTGCGG + Intronic
1022496381 7:30855589-30855611 AGCTGCCCACTGATGGACTGGGG + Intronic
1024039621 7:45542187-45542209 GGCTGGACTCAGATGGCTTCTGG - Intergenic
1024983713 7:55178445-55178467 GCCTTCACACAGAGGACCTGGGG + Intronic
1025607187 7:63047778-63047800 GCCTGCACCCAGCAGGCCTGGGG - Intergenic
1026201537 7:68218661-68218683 GCCTGCATCCAGATGGCCTAAGG - Intergenic
1027205699 7:76096425-76096447 GGCTGGACACAGGTGGCCCATGG + Intergenic
1027277240 7:76570533-76570555 GGAGGCAGACATATGGCCTGTGG - Intergenic
1029131249 7:98332938-98332960 GTCTGCAGACAGAAGGCATGAGG - Intronic
1029316784 7:99723177-99723199 GGGTACATCCAGATGGCCTGAGG + Intronic
1032062913 7:128739588-128739610 GGCTGCACACAGAGGGTCCCGGG - Intronic
1032400482 7:131620839-131620861 AGCTGCACTGTGATGGCCTGTGG + Intergenic
1033238226 7:139655442-139655464 GGCTGTAGACAGAAGGCGTGTGG + Intronic
1034399961 7:150855651-150855673 GGCTGCAGACTGATGGCTTTGGG - Intronic
1034997289 7:155586182-155586204 AGCTGCACACACATGCGCTGTGG + Intergenic
1035309464 7:157956028-157956050 AGCAGCACACGAATGGCCTGGGG - Intronic
1035689892 8:1553205-1553227 GGCTGCAGAGAGGAGGCCTGAGG - Intronic
1036777744 8:11625247-11625269 GCCTGCACCCAGCAGGCCTGGGG + Intergenic
1038415215 8:27389949-27389971 GGCTGCACTCAGCAGGCCTTTGG + Intronic
1038581292 8:28751433-28751455 TGCTGCACACAGATGGCGCTGGG - Exonic
1039586901 8:38714456-38714478 GGCTGCACACACATGGACATCGG - Intergenic
1039960740 8:42245455-42245477 AGCTGCTGGCAGATGGCCTGGGG - Intergenic
1041382036 8:57260787-57260809 GAATGGACCCAGATGGCCTGAGG - Intergenic
1042802786 8:72738677-72738699 AACTGCACACAGTTGGCATGTGG + Intronic
1049077440 8:140410301-140410323 TGCGGCAGACAGATCGCCTGAGG + Intronic
1049269576 8:141687154-141687176 GGCTGCCCACAGGAGGCCAGAGG - Intergenic
1049580598 8:143408891-143408913 GGCTGCCCGGAGAGGGCCTGAGG + Intergenic
1049604074 8:143521038-143521060 AGCTGCAAACAGCTGGCCTGGGG + Intronic
1049743970 8:144255263-144255285 AGCTGAGAACAGATGGCCTGAGG + Intronic
1051307065 9:15721894-15721916 GGCTCCACACATATAGCCTTCGG + Intronic
1051667181 9:19476411-19476433 GGCAGCACACAGTGGGCCAGGGG - Intergenic
1051720254 9:20029476-20029498 TGCTGCAGTCAGATGGACTGAGG - Intergenic
1052487552 9:29121171-29121193 TGATGCACACAGATGAGCTGAGG + Intergenic
1054718070 9:68577304-68577326 GGTTACACACTGGTGGCCTGTGG + Intergenic
1056692933 9:88823607-88823629 GGCTGAACCCAGCTGGCATGTGG - Intergenic
1056958825 9:91104045-91104067 GGGGGCACAAAGATGGCCTTGGG + Intergenic
1057195638 9:93114561-93114583 GGGTGCACACAGATGGACAGGGG - Intergenic
1059339491 9:113589552-113589574 GGCTCCACACAATGGGCCTGGGG - Intronic
1059779011 9:117507491-117507513 GGCTGCACACAGCATCCCTGGGG + Intergenic
1060820775 9:126660460-126660482 TGCTGCAGCCAGGTGGCCTGGGG + Intronic
1060972774 9:127748311-127748333 GGCTGCAGCCACTTGGCCTGTGG - Intronic
1061517489 9:131098105-131098127 GGCTGCACACTGCTGGCAAGAGG - Intronic
1062096796 9:134707815-134707837 GGCTGCCCAGTGATGGGCTGCGG - Intronic
1062180284 9:135187721-135187743 GGCAGCACAGGCATGGCCTGTGG - Intergenic
1062191669 9:135251020-135251042 GGCTGCACCCAGCTAGCCTGTGG + Intergenic
1203521762 Un_GL000213v1:52612-52634 GGCTGGCCCCAGACGGCCTGAGG - Intergenic
1185486244 X:483948-483970 GGATGTATACAGCTGGCCTGTGG + Intergenic
1185486274 X:484152-484174 GGATGTATACAGTTGGCCTGTGG + Intergenic
1185486295 X:484274-484296 GGATGTATACAGCTGGCCTGTGG + Intergenic
1186485670 X:9932619-9932641 TGCTGAACACAGAGGGGCTGTGG - Exonic
1193210479 X:78801722-78801744 GGCTGCACACAGCAGGCCGGGGG - Intergenic
1196718478 X:118831972-118831994 GAGAGAACACAGATGGCCTGGGG - Intergenic
1197623986 X:128782020-128782042 GGCTGCACACTGAAGCCCTGGGG - Intergenic
1198494218 X:137174434-137174456 AGCTGGACATGGATGGCCTGGGG + Intergenic
1199305817 X:146266402-146266424 GACTGAACACAACTGGCCTGTGG - Intergenic
1200076738 X:153554897-153554919 GGCTACACACACTGGGCCTGAGG + Intronic