ID: 953032774

View in Genome Browser
Species Human (GRCh38)
Location 3:39188988-39189010
Sequence ACGTCTCCTCCACCTGGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953032770_953032774 -7 Left 953032770 3:39188972-39188994 CCAGCGGGCTGCACGAACGTCTC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 953032774 3:39188988-39189010 ACGTCTCCTCCACCTGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 179
953032765_953032774 29 Left 953032765 3:39188936-39188958 CCCTGTCAGCTCGTCCAGTGGCT 0: 1
1: 0
2: 0
3: 16
4: 107
Right 953032774 3:39188988-39189010 ACGTCTCCTCCACCTGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 179
953032766_953032774 28 Left 953032766 3:39188937-39188959 CCTGTCAGCTCGTCCAGTGGCTT 0: 1
1: 0
2: 0
3: 10
4: 84
Right 953032774 3:39188988-39189010 ACGTCTCCTCCACCTGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 179
953032767_953032774 15 Left 953032767 3:39188950-39188972 CCAGTGGCTTTGTCTCAAATAGC 0: 1
1: 0
2: 4
3: 53
4: 262
Right 953032774 3:39188988-39189010 ACGTCTCCTCCACCTGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953032774 Original CRISPR ACGTCTCCTCCACCTGGCTG GGG Exonic
900555160 1:3276656-3276678 ACGGCACCTCGAGCTGGCTGGGG - Intronic
901453537 1:9350706-9350728 GCGTCTGCTCCTCCTGGGTGGGG + Intronic
902826628 1:18979061-18979083 CTGCCTCCTCCACCAGGCTGGGG - Intergenic
903535241 1:24062512-24062534 ATGTCTGCTCCACAAGGCTGAGG + Intronic
905483919 1:38282346-38282368 ATGTCTCCACCTCCTGGCTTTGG - Intergenic
906040444 1:42784807-42784829 ACGTCTCCTCTACCTGGGCCAGG - Intronic
908048559 1:60201541-60201563 ATTTCTCCTCCATCTGGCAGTGG - Intergenic
908580642 1:65512437-65512459 ACTGCTCCTACACCTTGCTGAGG - Intronic
912495046 1:110086122-110086144 CAGTCCCCTCCACCCGGCTGGGG + Intergenic
915680475 1:157577202-157577224 AGATCTCCTTCACCAGGCTGGGG - Intronic
922183938 1:223257780-223257802 GCGTCTCCCCCACATGTCTGGGG + Intronic
922364595 1:224851962-224851984 ATGTTTCCTCCACGGGGCTGGGG + Intergenic
923074991 1:230602161-230602183 ACCTCTTCTCCACCTTTCTGGGG + Intergenic
923774440 1:236965953-236965975 CCCTCTCATCCACCTGGCAGAGG - Intergenic
1063022854 10:2146822-2146844 GTGTCTGCTCCACCTGTCTGTGG + Intergenic
1067780251 10:49197221-49197243 ACGTCACCTCCACCTAGCATTGG - Intergenic
1067838079 10:49653904-49653926 ACCCCTCCTCCTCCTGCCTGTGG + Intronic
1070313886 10:75293416-75293438 ACGTCTCCTCCTCATGGCACAGG - Intergenic
1071436238 10:85650382-85650404 ACGTCTCCTTCATCTCTCTGTGG - Intronic
1075071889 10:119325330-119325352 ACCTGTCCTCCACCTTGCTCTGG - Intronic
1076889640 10:133277287-133277309 GCGCCCCCTCCACCAGGCTGAGG + Intergenic
1077132360 11:979501-979523 ACGGCTCCTCAGCCAGGCTGGGG - Intronic
1077448133 11:2612318-2612340 AAGCCTCCCCCAACTGGCTGTGG + Intronic
1078544517 11:12237328-12237350 TCTTCTCCACCACTTGGCTGTGG + Intronic
1080049741 11:27847364-27847386 TCATCTCCTGCTCCTGGCTGTGG + Intergenic
1080135616 11:28850809-28850831 ACGTCTCCTCCCCCAGGCCATGG - Intergenic
1080678287 11:34448290-34448312 ACGCCACCTCCACCTGGGAGAGG - Intronic
1083853515 11:65380860-65380882 GCCTCTGCCCCACCTGGCTGTGG - Intronic
1084707720 11:70825008-70825030 ATGTCTCCTCCACATGGGTAGGG - Intronic
1087897154 11:103599369-103599391 GCGTCTCCTTCACACGGCTGTGG + Intergenic
1090801323 11:130174230-130174252 CCGCCTCCCTCACCTGGCTGTGG - Intronic
1091621542 12:2092999-2093021 CCGTCACCTCCTCCAGGCTGTGG - Intronic
1093562029 12:20552771-20552793 ACGTCTCCTCCACTTTACTCAGG - Intronic
1095982142 12:47979853-47979875 CCCTCTCTCCCACCTGGCTGTGG + Intronic
1097155191 12:57006893-57006915 ATATCTCCTCCACTAGGCTGTGG + Intergenic
1100245212 12:92750807-92750829 AGGTCTCCTCCAAATGACTGTGG - Intronic
1107167068 13:37295155-37295177 TCCTTGCCTCCACCTGGCTGAGG + Intergenic
1108574432 13:51779280-51779302 AAGTCTACTGCACCAGGCTGAGG - Intronic
1113821285 13:113215321-113215343 AGGTCTCATCCATGTGGCTGTGG + Intronic
1113821313 13:113215510-113215532 AGGTCTCGTCCATGTGGCTGTGG + Intronic
1113821370 13:113215903-113215925 AGGTCTCGTCCATGTGGCTGTGG + Intronic
1113821393 13:113216040-113216062 AGGTCTCGTCCACGTGGCTGTGG + Intronic
1114334697 14:21676404-21676426 AGGGCTCCTCCACGTGGCTCAGG + Intergenic
1114849116 14:26361166-26361188 ACATCTCATCCACCTAGCTCAGG + Intergenic
1118243146 14:64081310-64081332 ATGTCTGCTCCCCATGGCTGGGG - Intronic
1118319367 14:64744040-64744062 TGGGCTCCTCCATCTGGCTGTGG - Exonic
1119401486 14:74365560-74365582 ACTTCTCCTCCTCCTGGCCCTGG - Intergenic
1119479236 14:74949455-74949477 ACATGTGCTCCACCTCGCTGGGG + Exonic
1121456905 14:94044135-94044157 AGCTCTGCTCCTCCTGGCTGGGG + Intronic
1121736583 14:96222179-96222201 GCCTCTCTTCCACCTGGCTGTGG - Intronic
1122691278 14:103533171-103533193 ACCTCTCCTCCCCCAGGCTCTGG + Intronic
1125679903 15:41524040-41524062 AGGGCTCCTCCACAGGGCTGGGG - Intronic
1128279737 15:66385263-66385285 AGGTCACCAACACCTGGCTGTGG + Intronic
1129793797 15:78360939-78360961 GCATCTCCTCCACCTGGCCTGGG + Intergenic
1129903580 15:79170386-79170408 GCGTGTCTTCCAGCTGGCTGTGG + Intergenic
1132666468 16:1083320-1083342 ACGACACCTCCTCCTGCCTGTGG - Intergenic
1132697161 16:1207164-1207186 ACGGCACCTCCACCTCTCTGGGG - Intronic
1135190177 16:20348307-20348329 ACGTCCCCTCCACGGAGCTGGGG + Exonic
1136370160 16:29831108-29831130 ACCTGTCCTCCACCTGCCTTGGG + Intronic
1138185171 16:54971216-54971238 AAGTCTTCTCCACCTGCCAGAGG + Intergenic
1139963409 16:70730866-70730888 AAATCTCCTCCACCTGGCTTTGG + Intronic
1140195904 16:72855163-72855185 ACGTCAACTCCACAAGGCTGGGG + Intronic
1141549387 16:84795208-84795230 ACCTCTCCTTCATCTCGCTGCGG + Intergenic
1142218651 16:88842122-88842144 GCGTCTCCACCACCTGGGTGGGG + Intronic
1142438105 16:90076057-90076079 CTGTCTTCTCCATCTGGCTGGGG + Intronic
1142978721 17:3659556-3659578 CCGTCTCCTCCACATCCCTGGGG - Intronic
1144297001 17:13885701-13885723 ACGCTGCCTCCACCTGGCTTTGG - Intergenic
1145190865 17:20841691-20841713 GTGCCTCCTCCACATGGCTGAGG + Intronic
1146786951 17:35729349-35729371 ATGTCTGCTCCCCCAGGCTGTGG - Intronic
1150818427 17:68414129-68414151 TTGGCTCCTCCCCCTGGCTGTGG + Intronic
1151715670 17:75829945-75829967 AGGCCTGCTCCTCCTGGCTGGGG - Intronic
1152466059 17:80466739-80466761 GGGTCACCTGCACCTGGCTGGGG + Intergenic
1152844712 17:82592713-82592735 GCATCTCCTCAAGCTGGCTGGGG + Intronic
1153309165 18:3661295-3661317 ACATAGCCTCCACCTGTCTGTGG - Intronic
1158557223 18:58485466-58485488 GCCCCTCCTCCTCCTGGCTGGGG + Intronic
1160671221 19:364674-364696 GCATCTCCTCCCCCTGGCTGGGG + Intronic
1160683780 19:424220-424242 AAGCCTCCTCCGCCCGGCTGGGG + Intronic
1160833640 19:1114456-1114478 CCTGCTCCTCCACCTTGCTGCGG - Intronic
1161558287 19:4956720-4956742 ACGTCTCCTCCACTTTACTCAGG - Exonic
1164706804 19:30325858-30325880 ACCTATCCTCCATGTGGCTGTGG + Intronic
1164819266 19:31232427-31232449 AGCTCAGCTCCACCTGGCTGTGG + Intergenic
1165436188 19:35796832-35796854 CCGTCTGCACCACCTGGCTGTGG - Intergenic
1166719310 19:44988257-44988279 ACATGTCCTCCCCCTGCCTGGGG + Intronic
1166781910 19:45347491-45347513 TCCTCTCCTCCTCCTCGCTGGGG - Exonic
1166934027 19:46320437-46320459 CGGTCTCTTCCACCTGGCTGGGG - Exonic
928287874 2:30009041-30009063 AAGTTTCCTCCATCTTGCTGGGG - Intergenic
928883879 2:36126977-36126999 CCATCCCCTCCACCTGTCTGGGG + Intergenic
932043062 2:68319823-68319845 ACCTCTCCTCCTCCTGCCCGGGG - Exonic
932575235 2:72959091-72959113 ACCTCTCCTCCACCTCTCTTGGG + Intronic
933278965 2:80311392-80311414 CCCTCTCCTTCATCTGGCTGGGG + Intronic
934559799 2:95307153-95307175 CAGGCTCCTCCATCTGGCTGAGG - Intronic
935441727 2:103105728-103105750 ATGCCTCCACCACCTAGCTGAGG + Intergenic
937063105 2:118994750-118994772 ACCTCTCCTTCCCCTGGCTACGG - Intergenic
937907040 2:127057508-127057530 ACGTGTCCTCAAACAGGCTGAGG + Exonic
946397723 2:219451665-219451687 CCGCCTCCTCCTCCGGGCTGAGG + Exonic
947931693 2:233970096-233970118 CCGTCTCTTCCTCCTGGCTATGG + Intronic
948560765 2:238849488-238849510 AGGTCAGCTCCACCTGCCTGCGG - Intronic
948861148 2:240753130-240753152 AAGTCTCCTCCCTCTGGGTGTGG - Intronic
1169473642 20:5911102-5911124 GTGTCTCCTCGACCTAGCTGAGG - Intergenic
1170838512 20:19905114-19905136 AGGTCCCCTTGACCTGGCTGGGG + Intronic
1170933118 20:20787011-20787033 ACTCCTCCTCCACCAGGCTCTGG + Intergenic
1171410505 20:24943842-24943864 ACGTGTCCTCCCCCTGCCTTTGG - Intergenic
1174767923 20:53271245-53271267 GAGTCTCCTCTTCCTGGCTGAGG + Intronic
1175751355 20:61500096-61500118 GGGCCTCCTCCTCCTGGCTGAGG - Intronic
1177791157 21:25723208-25723230 AGCTCTCCTCCACCTACCTGTGG - Intronic
1177798825 21:25807305-25807327 ACCACTCCTCCTCATGGCTGAGG + Intergenic
1179232736 21:39519670-39519692 GCGCCTCCTCCGCCTGGCTTTGG + Intergenic
1179647450 21:42784501-42784523 TTCTGTCCTCCACCTGGCTGGGG + Intergenic
1180160946 21:45998443-45998465 CCCCCTCCTCCATCTGGCTGTGG + Intronic
1181106415 22:20578451-20578473 CAGTCTCCCACACCTGGCTGTGG + Intronic
1182165831 22:28172070-28172092 TCTTCTCCACCACCTGGCTAGGG + Intronic
1183464179 22:37971183-37971205 TCATCCCCTCCACCTGCCTGTGG - Intronic
1183774602 22:39955647-39955669 ACGGCTCCTCCACAGGCCTGGGG + Intronic
1184178947 22:42806317-42806339 ACTTCCCCTCCCCCTGACTGAGG - Intronic
1184388131 22:44187826-44187848 ACATGTCCTCCTCCAGGCTGCGG - Exonic
1184597921 22:45525564-45525586 GCAGCTCCTCCAGCTGGCTGTGG - Exonic
1184620309 22:45671835-45671857 CCGTCTCCTCCTCCCGCCTGAGG + Exonic
950667920 3:14508448-14508470 CCTTTTCCTCCACCTGGCTCAGG - Intronic
953032774 3:39188988-39189010 ACGTCTCCTCCACCTGGCTGGGG + Exonic
953352284 3:42224222-42224244 ACGTCAGCTGCACGTGGCTGAGG - Exonic
953828094 3:46271604-46271626 TCCTCTCCTCCTCATGGCTGAGG - Intergenic
954692575 3:52403446-52403468 AGGCCTGCTGCACCTGGCTGAGG - Exonic
957556883 3:81773694-81773716 AATTCTCCTCCACTTGACTGTGG + Intergenic
960096909 3:113697585-113697607 AGGTGTCCTCCACCTAGTTGCGG + Intergenic
960278928 3:115759142-115759164 CCATCTCCTTCACTTGGCTGAGG + Intergenic
961122410 3:124384281-124384303 GCATCTCCTCCCTCTGGCTGTGG + Intronic
965628166 3:170703289-170703311 ACTTCTGCTCCACATGTCTGGGG + Intronic
967494627 3:190128953-190128975 CCTTGTCCTCCATCTGGCTGGGG - Intergenic
968441293 4:625773-625795 TGCTCTCCTCCACCTGGCAGAGG - Exonic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969220644 4:5756420-5756442 ACCTCACATCCTCCTGGCTGGGG + Intronic
969427423 4:7133522-7133544 CCGTCTCCTCCACTAGACTGTGG + Intergenic
972975719 4:44633154-44633176 TCATCTCCCCAACCTGGCTGTGG + Intronic
974758241 4:66241222-66241244 AAGTGTTCTCCAGCTGGCTGAGG - Intergenic
976922108 4:90453943-90453965 AGGGCTCCTCTACCTGGCTCTGG - Intronic
982099328 4:151953023-151953045 ACGTCACCATCACGTGGCTGGGG + Intergenic
984759460 4:183351191-183351213 ACCTCTCCCCCATCAGGCTGAGG - Intergenic
985724004 5:1506216-1506238 ACTGCTCCTCCTCCTGCCTGGGG - Intronic
986892309 5:12323867-12323889 ACGTGGCTTCCACCTGGCCGTGG - Intergenic
994953516 5:106497386-106497408 ATGTTTCCTCCACCAGACTGTGG + Intergenic
997227891 5:132223068-132223090 TAGTCTCCTCCACTGGGCTGAGG - Intronic
998153696 5:139771988-139772010 ACCTCTCCCTCACCTGGCTGGGG - Intergenic
998680649 5:144463096-144463118 AAGTCTCCTCCTCTTGGCTCAGG - Intronic
999255365 5:150206927-150206949 ATGCCCCTTCCACCTGGCTGTGG - Intronic
1001931718 5:175677885-175677907 ACTTCCCCTCCACCTGCCGGAGG + Intronic
1002398560 5:178977020-178977042 CTGTCACCTCCATCTGGCTGTGG - Intergenic
1002456457 5:179347892-179347914 AAGTCTCCTCCACCTCCCTGAGG - Intergenic
1003174346 6:3744290-3744312 GCTCCTCCTCCACCAGGCTGGGG + Intronic
1003842986 6:10141625-10141647 ATTTCTGCTCCAGCTGGCTGGGG + Intronic
1006518265 6:34556439-34556461 AGGTCTCCCCCTCCTTGCTGGGG + Intergenic
1007486625 6:42184942-42184964 ACCTCTCCTCCCCCTTGCTCAGG - Exonic
1007616227 6:43181112-43181134 AGGTCTCCTCCCCATGGGTGGGG - Exonic
1008743710 6:54642635-54642657 ACTTCTCCTCCAGCTGCCTGGGG - Intergenic
1012399434 6:98832273-98832295 ACTTCTCCCCCACCTTTCTGGGG - Intergenic
1012955753 6:105567983-105568005 ACTTCTCCTCCTCCTGGCCCAGG - Intergenic
1013207772 6:107959570-107959592 GCCTCTCCTTCCCCTGGCTGTGG + Intergenic
1014211928 6:118717182-118717204 ACGTCACTTTCACCTGGATGTGG - Intergenic
1015440637 6:133242106-133242128 ACCCCGCCTCCACCTGGCAGAGG + Intronic
1015565684 6:134567996-134568018 ATGTCTCCTTCACCTAGGTGTGG + Intergenic
1017196243 6:151703670-151703692 ACGAGTCTTCCATCTGGCTGAGG + Intronic
1018659639 6:166074033-166074055 ACGGCTCCTCCACCTGTCCCTGG - Intergenic
1019163325 6:170083327-170083349 GCGTCTGCGCCACCTGGGTGTGG - Intergenic
1019347432 7:537955-537977 TCGACTCCCCCACCAGGCTGTGG + Intergenic
1020475014 7:8583811-8583833 ACCTCTCCTCCACCTCTCAGAGG - Intronic
1021519255 7:21522771-21522793 AAGTCCCCTCCACTTGGGTGTGG + Intergenic
1022197516 7:28083079-28083101 AAATCCCCTCTACCTGGCTGGGG + Intronic
1023894403 7:44419722-44419744 AGGTCTGCTCCAATTGGCTGAGG - Intronic
1029196372 7:98808401-98808423 AGGTGTCCCCCACCTGACTGGGG + Intergenic
1029219920 7:98980530-98980552 ACATGGTCTCCACCTGGCTGAGG + Intronic
1035157431 7:156925655-156925677 TCATCTCCTCCACCTGGCCTGGG - Intergenic
1037964042 8:23119451-23119473 ACACCTCCTCCACCAGACTGTGG - Intergenic
1037976716 8:23219150-23219172 ACACCTCCTCCACCAGACTGTGG + Intronic
1045224598 8:100232230-100232252 ACTCCTCCTCCTCTTGGCTGCGG + Intronic
1049299555 8:141862373-141862395 TAGTCTCCTGCACCCGGCTGAGG + Intergenic
1049682514 8:143926008-143926030 CTGTCTCCTCCGCCGGGCTGGGG - Intronic
1051710722 9:19927956-19927978 GGGTCTGCTGCACCTGGCTGGGG + Intergenic
1056222496 9:84464203-84464225 TCATCTCCTCCACCTGGCCCTGG + Intergenic
1056468819 9:86885368-86885390 AAGTCTCCAACACCTTGCTGGGG - Intergenic
1057759395 9:97860454-97860476 GCATCTCCTCTCCCTGGCTGAGG + Intergenic
1058839459 9:108892098-108892120 TTGTCGCCTCCACCAGGCTGTGG - Intronic
1062284093 9:135765449-135765471 AGGGCCCCTCCACCTGACTGTGG - Intronic
1062344277 9:136107655-136107677 CACCCTCCTCCACCTGGCTGGGG - Intergenic
1062423787 9:136496904-136496926 TCGTCTCTCCCACCTGCCTGTGG - Exonic
1187601227 X:20832729-20832751 ACGTTTTCTGGACCTGGCTGGGG - Intergenic
1188027361 X:25224188-25224210 CCGTCTCCTGCACCAGGATGAGG + Intergenic
1189850122 X:45169506-45169528 ACCTCTCCTCCAGCTGGCCCAGG + Intronic
1200184905 X:154175874-154175896 CCGTCTTCCCCACCTGGCTCGGG + Intergenic
1200190558 X:154213012-154213034 CCGTCTTCCCCACCTGGCTCGGG + Intergenic
1200196309 X:154250814-154250836 CCGTCTTCCCCACCTGGCTCGGG + Intergenic
1200201964 X:154287932-154287954 CCGTCTTCCCCACCTGGCTCGGG + Exonic