ID: 953033405

View in Genome Browser
Species Human (GRCh38)
Location 3:39192105-39192127
Sequence GGCTTCAGGGCTTCCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953033405_953033414 28 Left 953033405 3:39192105-39192127 CCCTGGGAGGAAGCCCTGAAGCC 0: 1
1: 0
2: 3
3: 25
4: 263
Right 953033414 3:39192156-39192178 ATCACAACTCCAGGCCTTTCTGG 0: 1
1: 0
2: 3
3: 11
4: 182
953033405_953033413 19 Left 953033405 3:39192105-39192127 CCCTGGGAGGAAGCCCTGAAGCC 0: 1
1: 0
2: 3
3: 25
4: 263
Right 953033413 3:39192147-39192169 ATTTTAAAAATCACAACTCCAGG 0: 1
1: 1
2: 10
3: 89
4: 722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953033405 Original CRISPR GGCTTCAGGGCTTCCTCCCA GGG (reversed) Intronic
901079678 1:6576840-6576862 GCCCTCAGGGCTCACTCCCAGGG - Intronic
902769229 1:18636146-18636168 GGCTTCCTGACTTTCTCCCAGGG + Intronic
903191016 1:21656016-21656038 GGCGTCTGGGCTTCCTGCCCTGG + Intronic
903251400 1:22055915-22055937 GGCTACAGGGCTTCCTTTGAAGG + Intronic
903663280 1:24991663-24991685 GGATTCAGGGGATGCTCCCAAGG - Intergenic
906207629 1:43995637-43995659 GGCTCCAGGGCTGCCTCAGAGGG - Exonic
906258012 1:44365495-44365517 AGCTCCAGGGCTTGGTCCCAGGG + Intergenic
907283969 1:53368661-53368683 GGCCTCAGCCATTCCTCCCAGGG + Intergenic
907515693 1:54991921-54991943 GGCTCCAGGGCTTCCTCCGTAGG - Exonic
908034176 1:60034106-60034128 TGGTTCAGGATTTCCTCCCAGGG - Intronic
908203611 1:61822535-61822557 GAACTCAGGGCTTCCTGCCATGG + Intronic
910106581 1:83637772-83637794 GGCTTCAGGTCTTCCTCTGCTGG - Intergenic
913030864 1:114901616-114901638 GGTTACAGGTCTTGCTCCCAAGG + Intronic
922706617 1:227793838-227793860 GGCTGCCTGTCTTCCTCCCAGGG - Intergenic
924223950 1:241905461-241905483 GGTTTCAGGGCTGCATTCCAAGG + Intergenic
1064328710 10:14374326-14374348 GTCCTCATGGCTTCCTCCCACGG + Intronic
1065104844 10:22372516-22372538 GGCTCCAGGCCCTCCTCCCCTGG + Intronic
1067164100 10:43851701-43851723 GGCTTCAGTGCGCCCTCCCCAGG - Intergenic
1067758500 10:49025458-49025480 GGCTCTAGGACTTCCTCACATGG + Intronic
1067833230 10:49622058-49622080 GGCCTGAGCCCTTCCTCCCAGGG - Intronic
1068096165 10:52494122-52494144 GTCAGCAGGGCTCCCTCCCAAGG + Intergenic
1068767888 10:60784532-60784554 GGGCTCAGGGGATCCTCCCACGG - Intronic
1069779852 10:70948405-70948427 AACTTCAGGCCTTCCTCCCAAGG - Intergenic
1071337898 10:84616639-84616661 GGCTTCAGGGCTCACTGCCCAGG + Intergenic
1072034545 10:91552255-91552277 GGCTCCAGGGCTTTCTTCCTAGG + Intergenic
1072685743 10:97535683-97535705 GGCTTCAAGTGATCCTCCCATGG - Intronic
1074357323 10:112798057-112798079 GGCTCCAAAGCTTCCTTCCAGGG + Intronic
1074387423 10:113027821-113027843 GGCTGCAGGGCTACCTCCTGGGG - Intronic
1076164332 10:128269587-128269609 GTATCCAGGGCCTCCTCCCAAGG + Intergenic
1076289781 10:129336267-129336289 GTTCTCAGGGCTTCCTCCCCTGG - Intergenic
1076770411 10:132659779-132659801 GGCTTCATGGCTGCCTGCCCTGG + Intronic
1076947276 10:133659906-133659928 GACTTCAGGGCAGCCTCTCAGGG - Intergenic
1077305488 11:1866979-1867001 GGCTTCAGTGTCTCCTCCCCAGG - Intronic
1077305506 11:1867036-1867058 GGCTTCAGTGCCTCCTCCCCAGG - Intronic
1077333745 11:1994419-1994441 GGCTCCCGGGCTCCCTCCCCGGG - Intergenic
1078355615 11:10629559-10629581 TGCTCCTGGACTTCCTCCCACGG + Exonic
1079306621 11:19329167-19329189 GGCTGCATGGACTCCTCCCAAGG + Intergenic
1079338080 11:19588963-19588985 GGCCTCTGGGATGCCTCCCATGG + Intronic
1079710680 11:23679736-23679758 CGCTCTAGGGCTTCCTCTCAGGG - Intergenic
1079867887 11:25758453-25758475 GGCTTCAGGCCCTCTTTCCAGGG - Intergenic
1081590166 11:44417167-44417189 GGCTTCAGGGCTCCCCACCCAGG - Intergenic
1083592547 11:63904097-63904119 GGCCTCTGGGCTGCCCCCCACGG + Exonic
1083777564 11:64901774-64901796 AGCATCAGGGCTGCCTCCCTAGG + Intronic
1084064976 11:66698874-66698896 CCCTTCATGGCTTCTTCCCAAGG - Intronic
1084212779 11:67631573-67631595 GGTAGCAGGGCTTCCCCCCAGGG + Exonic
1084705038 11:70811127-70811149 GGCTTGTGGGCTTCCTCCCGAGG + Intronic
1087194298 11:95289853-95289875 GGCTTCAGGGGATCATCCAAAGG - Intergenic
1088228972 11:107653936-107653958 GCCTTTAGGGCTGTCTCCCATGG + Intronic
1088779076 11:113116383-113116405 GGCTGCAGTGCTTTCTCCAAGGG + Intronic
1089317919 11:117604859-117604881 GGATCCAGGGCTCCCTGCCATGG + Intronic
1089617443 11:119702926-119702948 GGGGACAGGGCTGCCTCCCAGGG - Intronic
1089972535 11:122705667-122705689 GGCTTCTGGGCTTCCTCACCAGG + Intronic
1091277200 11:134360555-134360577 GGCTCCCGGGCTTCCTTGCAAGG - Intronic
1202816725 11_KI270721v1_random:49601-49623 GGCTCCCGGGCTCCCTCCCCGGG - Intergenic
1091951762 12:4598697-4598719 GGCTTCCTGGTTCCCTCCCAAGG + Intronic
1092130917 12:6112653-6112675 GTCTTCTGGGCTTCGTTCCACGG - Intronic
1092489699 12:8933936-8933958 GGGTTCAATGCTTCCTGCCAAGG + Exonic
1092563534 12:9641515-9641537 GGTTACAGGTCTTGCTCCCAAGG + Intergenic
1092570769 12:9719202-9719224 GGTCTCAAGGGTTCCTCCCACGG - Intronic
1095158583 12:38888879-38888901 GCCTTCAGGCCTTCCAGCCATGG + Intronic
1095294835 12:40516092-40516114 GGCTGCAGGGGTGCCTGCCATGG - Intronic
1096946282 12:55412750-55412772 GGGTTCAATGCTTCCTGCCAAGG - Intergenic
1097024752 12:56046587-56046609 GACTTCACAGCTGCCTCCCAAGG + Intergenic
1098407168 12:70138967-70138989 GGCTTCAGGGCTTCATACAAAGG - Intergenic
1101860343 12:108477412-108477434 TGCTTCAGGGCCACCTCCCCTGG + Intergenic
1101978299 12:109381911-109381933 GGTTCCACTGCTTCCTCCCAAGG - Intronic
1102497737 12:113331009-113331031 GGCAAGAGGCCTTCCTCCCAGGG - Intronic
1103903161 12:124314087-124314109 GGCTTCAGAGCATCTGCCCAGGG + Intronic
1103932003 12:124455735-124455757 GGCTCTAGGGCCTCCTTCCAGGG - Intronic
1105619409 13:22052494-22052516 GGCGACAGGGGATCCTCCCATGG + Intergenic
1106583496 13:31037389-31037411 GGCTGCAGGGCTCCCTCTCTTGG - Intergenic
1107958861 13:45541992-45542014 GGCTGCCGGGCTTCTCCCCATGG + Intronic
1108756502 13:53509469-53509491 GGAGTCTGGGCTGCCTCCCAGGG + Intergenic
1110451630 13:75642986-75643008 GGTTTCAAGGCTTCTTCGCAAGG - Intronic
1113846306 13:113393813-113393835 GGCTGCAGGGCTTCCAGCCATGG - Intergenic
1113869011 13:113546649-113546671 GGCTGCCGGGCTTCCTCCGAGGG + Intronic
1114204810 14:20559181-20559203 GGGTTCAAGGAATCCTCCCACGG + Intronic
1115338755 14:32270157-32270179 GGTTTCATGGCTCCCTCCCTTGG + Intergenic
1116406161 14:44568472-44568494 GTCTTCAGGTCTTCCAGCCATGG - Intergenic
1117043705 14:51791285-51791307 GGTTGCAGGGCTTCCTCACTGGG - Intergenic
1118744096 14:68761626-68761648 GGGTTTGGGGCTCCCTCCCATGG - Intergenic
1118939231 14:70317285-70317307 GGCCTCACAGCTGCCTCCCAAGG + Intergenic
1119916931 14:78410870-78410892 GGAGTCAGGGCCTCCTGCCATGG + Intronic
1121049089 14:90808556-90808578 GGCTGCAGCCCTTCCACCCATGG - Intronic
1122791671 14:104186453-104186475 GGCTCCAGTGCCCCCTCCCACGG + Intergenic
1122969960 14:105148498-105148520 AGCTCCAGTGCTTCCTCCCCCGG - Intronic
1124477321 15:30045811-30045833 GGCCTCTGGGCTGCCTCCCACGG + Intergenic
1126849116 15:52786946-52786968 GGCTTCAGGGCCTCTTACCCAGG - Intronic
1128114053 15:65094452-65094474 GTCAGCAGGGCTTCCTGCCAGGG - Intronic
1128550548 15:68595542-68595564 GGCTTCAGGGGCTTCTCCCAGGG + Intronic
1129256585 15:74337334-74337356 GGCATGAGGACTTCCTGCCAAGG - Intergenic
1129921021 15:79319275-79319297 GGCAACAGGTCTACCTCCCAAGG - Intronic
1131465796 15:92654255-92654277 GGCTTCAGGGCTTGCTCTCCTGG - Intronic
1132516815 16:369893-369915 GCCTTCAGGGGCTCCTCTCAGGG - Intronic
1132547848 16:541380-541402 GGCTCCAGGGCTCCCCCACACGG - Intronic
1132929881 16:2453669-2453691 GACTGCAGGGCTCCGTCCCAGGG - Intronic
1135466694 16:22692812-22692834 TGCTTCTAGGCTCCCTCCCATGG + Intergenic
1137330646 16:47492182-47492204 GGTTGCAGGCCTTGCTCCCAAGG + Intronic
1137692681 16:50440615-50440637 GGCTTCTGGGCTTCCCCTCCTGG - Intergenic
1137772395 16:51026929-51026951 GGCTTCAGAGTTTAGTCCCAAGG - Intergenic
1138282696 16:55784086-55784108 GGCTTCCCGGCTTCCTGCCTCGG + Intergenic
1138472585 16:57249971-57249993 GGTTTGAGGGCTTCCTCCATAGG - Intronic
1138552836 16:57756711-57756733 TGCTCCAGCCCTTCCTCCCAAGG - Intronic
1138991102 16:62392127-62392149 GGCCTCTGGCCTGCCTCCCATGG - Intergenic
1139593707 16:67946678-67946700 TGCCTCTGGGCTCCCTCCCAAGG + Intronic
1141157195 16:81605513-81605535 GGGCTCAGGGATTCCTCCCAGGG - Intronic
1141771992 16:86095014-86095036 GGCCTCAGAGCTACCTCCCAAGG - Intergenic
1141889922 16:86919637-86919659 GGCTTGAGGTCTTTCTCCAAGGG + Intergenic
1144798747 17:17911167-17911189 GGCTTCAGGGCATCCTGGCCTGG + Intronic
1146645213 17:34572652-34572674 GGCTCCTGTGCTTCCTTCCAGGG + Intergenic
1146975882 17:37111439-37111461 TGCTTCAGTGCCTCCTCCCCTGG + Intronic
1147256667 17:39185821-39185843 GGCATCAGGGCTTCCTGCTGAGG - Intronic
1147741337 17:42672446-42672468 TGGTTCATGCCTTCCTCCCAGGG - Intronic
1148797484 17:50203979-50204001 AGTTCCAGGCCTTCCTCCCAGGG + Intergenic
1151398236 17:73839092-73839114 GGCTGGAGGGCTGGCTCCCAGGG - Intergenic
1151805056 17:76400035-76400057 GTCATCAGGGCTGCCCCCCAAGG + Intronic
1152078485 17:78172452-78172474 GGCCTCTGGGCTGCCTCCCGTGG + Exonic
1152149173 17:78588439-78588461 GGCTTCAGTCCTCCCTGCCAGGG + Intergenic
1152235108 17:79134655-79134677 GGCTTCAGGACCCCCTCCCTGGG - Intronic
1152344139 17:79741505-79741527 GGCTTCAGACCCTTCTCCCAGGG - Intronic
1203171179 17_GL000205v2_random:148906-148928 GACTTCAGGGCAGCCTCTCAGGG - Intergenic
1158947498 18:62459611-62459633 GGCTGCTGGGCCTCATCCCATGG + Intergenic
1161553098 19:4925249-4925271 GGGTTCAGGGTTTCCTTTCAAGG - Intronic
1163028765 19:14529682-14529704 TGCTTCATGGCTCCCTCCCACGG - Exonic
1165071363 19:33256619-33256641 GCCCTCAGGGCTTCTTTCCAGGG - Intergenic
1165826285 19:38707724-38707746 TGGTTCAGGGCGGCCTCCCATGG + Intronic
1165988684 19:39793042-39793064 GGCTTCTGGGATTGCTCCCCAGG - Intergenic
1166149078 19:40858023-40858045 GGATTCTGGGCTTGCTCCAAAGG - Intronic
1166660133 19:44641642-44641664 GGCTCCAGGGACTCCTCTCAGGG - Intergenic
1166668857 19:44698023-44698045 GGAACCTGGGCTTCCTCCCAAGG + Intergenic
1167120632 19:47514498-47514520 GGCTTCAGGACGTACTCCCTCGG + Intronic
1167613452 19:50518196-50518218 GGCTGCAGGGCCTCCTCTCCGGG + Exonic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925912132 2:8580983-8581005 GGCTTGAGGGCTTCCTCCTAGGG + Intergenic
929133687 2:38602816-38602838 CGCTCCAGAGCTTCCTCCCGGGG - Exonic
929488002 2:42372001-42372023 GGCTTCAGGGCCTGCTCCGCGGG - Intronic
929764244 2:44831032-44831054 GGCTTCCGGGCTTCCTCTGAAGG - Intergenic
930787434 2:55284349-55284371 GTCTTCAGGGCTCAATCCCATGG - Intergenic
932416827 2:71578650-71578672 GGCTACCTGGCTTCCACCCACGG - Intronic
935200365 2:100851459-100851481 TGCTTCGGGGACTCCTCCCAAGG + Intronic
935657580 2:105438267-105438289 TGCCTGAGAGCTTCCTCCCAGGG + Intronic
936900093 2:117472670-117472692 GGCTTCAGCCCTCCTTCCCAGGG - Intergenic
937219121 2:120331525-120331547 GGCTTGAGGGCTTGGTCCCTAGG - Intergenic
937352028 2:121172048-121172070 GGCTTCATGGCCTCCACCCCTGG + Intergenic
937356256 2:121199932-121199954 GGCTGCAGGCCTCCTTCCCATGG + Intergenic
937448064 2:121975481-121975503 GACCTCAGTGCTCCCTCCCAGGG - Intergenic
939222834 2:139325072-139325094 GGCTACAGGTTTTCCTCCCCAGG - Intergenic
940883772 2:158970666-158970688 TCCTTCAGGACTTCCTCCTAGGG + Intronic
942017666 2:171832994-171833016 GGCTTCATGGCTCCTTCCCTTGG + Intronic
942088102 2:172462234-172462256 GGTGTCAGCTCTTCCTCCCACGG + Intronic
943567688 2:189535796-189535818 AGCTTTAGAGCTCCCTCCCAGGG + Intergenic
947329801 2:229016349-229016371 GGTTTCAGGGCTTTCTGGCATGG + Intronic
948523612 2:238557543-238557565 GTCAGCAGGGCTGCCTCCCAGGG + Intergenic
948657537 2:239485928-239485950 GTCTTCAGGGCCTAGTCCCAGGG - Intergenic
1170421399 20:16196949-16196971 GACTCCAGGGCTTACTCTCATGG + Intergenic
1170846713 20:19968174-19968196 GGCATCACGGCTTCCTCCCAGGG + Intronic
1171565500 20:26181560-26181582 AGGCTCAGGTCTTCCTCCCAAGG + Intergenic
1172068505 20:32238950-32238972 GTCTTCAGAGGTTCCTTCCAGGG + Intergenic
1173810653 20:45953164-45953186 GGATTCAGGGCTTCCTCAGATGG + Intronic
1174582066 20:51579237-51579259 GGCTACTGGGCTTCCTCGGAAGG - Intergenic
1174595209 20:51678430-51678452 GACTTCAGCGCCTCCTCCTAGGG - Intronic
1174729874 20:52905423-52905445 GTCTTCAGGACTTTCCCCCAAGG + Intergenic
1175968002 20:62669258-62669280 GGCTGCAGGGCCTCCTCCTGGGG + Intronic
1176127691 20:63483282-63483304 GGCTTCTGGGCTCCCTGCCAAGG - Intergenic
1176167560 20:63682034-63682056 GGCTGCAGGGCTACCTCGCCTGG - Intronic
1176327163 21:5510736-5510758 GACTTCAGGGCAGCCTCTCAGGG - Intergenic
1176400594 21:6310215-6310237 GACTTCAGGGCAGCCTCTCAGGG + Intergenic
1176436563 21:6678889-6678911 GACTTCAGGGCAGCCTCTCAGGG - Intergenic
1176460825 21:7005959-7005981 GACTTCAGGGCAGCCTCTCAGGG - Intergenic
1176484386 21:7387737-7387759 GACTTCAGGGCAGCCTCTCAGGG - Intergenic
1176733588 21:10522218-10522240 GGCTCCTGCGCTTCCGCCCACGG + Intronic
1179914255 21:44466401-44466423 GGCCTCAGGTCATCCTCACATGG + Intergenic
1180226175 21:46393744-46393766 CACTGCAGGGCTTCTTCCCAAGG + Intronic
1180560310 22:16609991-16610013 GGCTCCTGCGCTTCCGCCCACGG - Intergenic
1180991659 22:19940962-19940984 GGGGTCAGGGCTCCTTCCCAGGG - Intronic
1181288065 22:21768817-21768839 CGCCTCAGGACTCCCTCCCATGG - Intronic
1182469354 22:30538490-30538512 GGCTTCAGTTCTTCCTCACAGGG - Intronic
1183035908 22:35141017-35141039 GGTTTCAGGGCTGGCTCACAGGG + Intergenic
1183234620 22:36608091-36608113 GTTTTCAGAGCTGCCTCCCAAGG + Intronic
1183382672 22:37498260-37498282 GGCGTCTGGTTTTCCTCCCATGG + Intronic
1183617122 22:38952744-38952766 GCCTTCAGGCCTCCCTGCCACGG + Exonic
1183745204 22:39687980-39688002 GGCTTCAGGGGGGCCTGCCAAGG + Exonic
1184227156 22:43135630-43135652 CACTTCTGGGCTTCCTTCCAAGG + Intronic
1184486873 22:44785077-44785099 GGCCTGAGGGCTGCCTCACATGG - Intronic
949543721 3:5054302-5054324 GGCTGCGTGGCTTTCTCCCAGGG + Intergenic
950547036 3:13644426-13644448 GGCCTCAGAGCCTCCTCCAAAGG - Intergenic
950632339 3:14290874-14290896 GGCTTCATGTTTTTCTCCCAGGG - Intergenic
951464983 3:22991210-22991232 TTCTCCATGGCTTCCTCCCATGG - Intergenic
953033405 3:39192105-39192127 GGCTTCAGGGCTTCCTCCCAGGG - Intronic
953645637 3:44751647-44751669 GGTTTCATGGCTCCCTCCCTTGG + Exonic
953908412 3:46880155-46880177 GATTTCAGGGCTGCCTCCTATGG - Intronic
954150346 3:48654275-48654297 AGCTTCAGGCCTACCTGCCATGG + Exonic
955400782 3:58589978-58590000 GGCTTCAGGGCTTGGTCCTTAGG + Intronic
957080180 3:75630510-75630532 GACTTCAGGGCAGCCTCTCAGGG + Intergenic
958817106 3:98928347-98928369 CTCCTGAGGGCTTCCTCCCAGGG - Intergenic
959980360 3:112509184-112509206 GCCACCATGGCTTCCTCCCAGGG + Intergenic
960532727 3:118782967-118782989 GCCTGCAGGACTTCCTCTCATGG - Intergenic
960901032 3:122554778-122554800 GGCTGCAGTGATTCCTGCCAGGG - Intronic
960941798 3:122939795-122939817 GGGTCAAGGGGTTCCTCCCAGGG - Intronic
961826386 3:129601422-129601444 GGCTCAAGGGATTCCTGCCAGGG + Intronic
962940495 3:140120761-140120783 ATCTTCAGGGCTTCCTCACTGGG + Intronic
963700385 3:148618579-148618601 GGCTTGTGGGCTTCCTGCCAAGG - Intergenic
966096199 3:176206260-176206282 GGCTTCAAGGCTGCCTTTCATGG - Intergenic
966816710 3:183895898-183895920 GGCTACAGGCCATCCTCCCTAGG + Intergenic
967061928 3:185880256-185880278 GGCCACAGGGCTTCCCTCCATGG - Intergenic
968127209 3:196168783-196168805 GGCTTCAAGGCCTCCTTCCTGGG - Intergenic
968517047 4:1019741-1019763 GGCTTCAGGGCTGGGGCCCATGG + Intronic
968954226 4:3710071-3710093 GGCCTCCGGGCCTCCTCCCCTGG - Intergenic
969254785 4:5994415-5994437 GGGTCCAGGGCCTCCTCCCTGGG + Intergenic
969703758 4:8781302-8781324 TGGTTCAGGGCTCCCACCCACGG - Intergenic
971286003 4:25290752-25290774 CCCTACAGGGCTTCGTCCCAGGG + Intergenic
972029017 4:34428729-34428751 AGGCTCAGGTCTTCCTCCCAAGG + Intergenic
973037437 4:45423789-45423811 GCCTTCAGGTCTTCCAGCCATGG + Intergenic
975989832 4:80247236-80247258 TACTTCAGGGCTTTCTCCTAAGG + Intergenic
978016877 4:103754882-103754904 GGATTCAGGGCTTCACCCTATGG + Intergenic
979292106 4:118989856-118989878 AGCCTCAGGGCTTACTCTCAGGG - Intronic
979765933 4:124463783-124463805 TGCTTCATGGCTGTCTCCCACGG + Intergenic
981077059 4:140602600-140602622 GGCTTCAGGTCTCCCAGCCATGG + Intergenic
985450734 4:190060706-190060728 GACTTCAGGGCAGCCTCTCAGGG - Intergenic
985822675 5:2170605-2170627 CCCTCCAGGCCTTCCTCCCAGGG + Intergenic
988968820 5:36445632-36445654 GGCCTCAGGGATTCCTCCCATGG + Intergenic
989109186 5:37890502-37890524 GGTTTCAGGGCTGCCTTCCCAGG - Intergenic
990323474 5:54651707-54651729 GAGCACAGGGCTTCCTCCCAGGG - Intergenic
990448905 5:55917595-55917617 GGCTTCAGGGCTACCTTGTAGGG - Intronic
992071953 5:73156413-73156435 GCCTTCAGGGCCTCCTGACAAGG + Intergenic
992858861 5:80891699-80891721 GGCTTCATGGCTCCTTCCCCTGG - Intergenic
995122545 5:108551689-108551711 GGTTTCAGGGCTTCTCCACATGG + Intergenic
996401668 5:123069479-123069501 GGCTTGAGGGGTTCCAGCCAAGG + Intergenic
996461354 5:123747087-123747109 GCCTACAGAACTTCCTCCCATGG + Intergenic
997456474 5:134021090-134021112 GGGTTCAGGTGATCCTCCCAGGG - Intergenic
1002847217 6:957515-957537 GGTTTCATGTCTTCCTCCAAGGG + Intergenic
1003119141 6:3305840-3305862 AACTTCAAGGCTTTCTCCCAGGG - Intronic
1004320920 6:14630741-14630763 GGCTTCAGGGATTCTGCTCAGGG - Intergenic
1006332688 6:33403727-33403749 AGCATCAGGTGTTCCTCCCATGG + Exonic
1006903181 6:37516124-37516146 GGCCTCTGGGCTGCCTGCCAGGG - Intergenic
1007386917 6:41526496-41526518 GGCTGCAGGGCCTGCTCCCCTGG - Intergenic
1007680656 6:43631046-43631068 GAGTCCATGGCTTCCTCCCAGGG + Intronic
1010872889 6:81063792-81063814 GGCTACAGGTCATGCTCCCAAGG + Intergenic
1011700186 6:89948578-89948600 CGCATCATGGCTTCCTACCAAGG - Intronic
1012515733 6:100057076-100057098 GTCCTCATGGCTTCCACCCATGG - Intergenic
1013836381 6:114341313-114341335 TGCTTCAGGGCACCCACCCAAGG - Intronic
1014576457 6:123080765-123080787 GGTATCAGGGCTTACTCTCATGG - Intergenic
1014878097 6:126685839-126685861 GTCTTCAGGTCTTCCAGCCATGG - Intergenic
1016467177 6:144337237-144337259 GAATTCAGGGTTTCCTCCCAGGG - Intronic
1017819699 6:158040418-158040440 AGACTCAAGGCTTCCTCCCAAGG - Intronic
1018747776 6:166775707-166775729 GGCTTCAGGGCTGCAGCCCGGGG + Intronic
1019568493 7:1696810-1696832 GGGGCCAGGGCTTCATCCCAGGG + Intronic
1021654874 7:22865056-22865078 GGCTCTAGTGCCTCCTCCCAGGG + Intergenic
1022127522 7:27372627-27372649 TGCCTCAGGCCTTCCTCCCCTGG - Intergenic
1023541792 7:41274132-41274154 GGCTTTAGGGTTTCCTGCCGAGG - Intergenic
1026946157 7:74317579-74317601 GGCTGGAGTGCTTCCCCCCACGG - Exonic
1028584371 7:92438451-92438473 GGATTCTGGGCTTCATACCAAGG + Intergenic
1029256159 7:99271042-99271064 GGCTTCGGGGCTTCCTCATGAGG + Intergenic
1034939768 7:155222915-155222937 GGCTTCTGGGATGCCTTCCATGG + Intergenic
1035029486 7:155848248-155848270 GGCCTCAGGGCCTCCTGCCAGGG - Intergenic
1035050875 7:155998524-155998546 GGCTTCCGGGCATCCCCCCAGGG - Intergenic
1037808254 8:22070185-22070207 GGTCTGAGGGCTGCCTCCCACGG - Exonic
1037834862 8:22209826-22209848 GGCTTCTGGGCTCCCACACAGGG - Intronic
1037895352 8:22648698-22648720 TGCATGATGGCTTCCTCCCAAGG - Intronic
1038414107 8:27380724-27380746 GGCTGCAGGCCTCCCTCCCAGGG - Intronic
1038478601 8:27886222-27886244 AGACTCAGGGCTTCCCCCCATGG + Intronic
1039707619 8:40023443-40023465 TGGTTCATGGCTTCCTACCAAGG - Intergenic
1039836010 8:41256820-41256842 GGGGTCAGTGCTCCCTCCCAAGG - Intergenic
1040542955 8:48376202-48376224 GCCTTCAAGGCCTCATCCCAAGG + Intergenic
1040763091 8:50874330-50874352 GGCTGCATGGCTTGGTCCCAAGG + Intergenic
1040867936 8:52069828-52069850 GTCTTCAGGTCTTCCAGCCATGG + Intergenic
1042149066 8:65762019-65762041 GGCTGCAGGGCTCCCTCTCGTGG - Intronic
1048074889 8:131058869-131058891 GGCTACAGGCCATGCTCCCAGGG - Intergenic
1048883371 8:138888347-138888369 GGCTTCCCAGCTTCCTTCCAAGG + Intronic
1048970961 8:139644800-139644822 GGCTTCAGGGCCACCTCCGCTGG + Intronic
1050918859 9:11173260-11173282 GGCTTCTGGGTTTCCACCCTGGG + Intergenic
1053020683 9:34691807-34691829 GGGTCCTGGGCCTCCTCCCAAGG - Intergenic
1053137313 9:35659159-35659181 CATTTCAGGGCCTCCTCCCAAGG - Intronic
1053353922 9:37430905-37430927 GGCTTCAGGGAGTGTTCCCAGGG + Intronic
1053477394 9:38392537-38392559 CGCTTCAGCGCTCCCTCCCTCGG - Intergenic
1053480709 9:38414483-38414505 GGCCTCAGTGCTCCCTCCCAGGG + Intronic
1055623513 9:78149988-78150010 GGTCTCTGGGCTGCCTCCCATGG - Intergenic
1056079037 9:83071777-83071799 GGCCTCAGGGCTGCTTCACATGG + Intergenic
1058784493 9:108374098-108374120 GTCTTCAGGCCTTCCAGCCATGG + Intergenic
1059143167 9:111873652-111873674 GTCTTCTGGTTTTCCTCCCATGG + Intergenic
1059243465 9:112828871-112828893 GGGTACAGGGTTTCCTTCCAGGG - Intronic
1059349889 9:113657020-113657042 AGCTTCCGGGCTTCTTCCCCAGG + Intergenic
1059470654 9:114503011-114503033 GCCTCAAGGGCTTCCTCCAAAGG + Intronic
1060193896 9:121610572-121610594 AGCTGCAGGGCTACCTCCTAAGG + Intronic
1061727448 9:132589533-132589555 GGCTCCGGGGCCTCCTCCCGCGG + Exonic
1203434949 Un_GL000195v1:129770-129792 GACTTCAGGGCAGCCTCTCAGGG + Intergenic
1185721956 X:2389358-2389380 GGATTCAGGGATTCAGCCCAGGG - Intronic
1187420721 X:19131340-19131362 GGCAGCAGGGCTTGCTCTCAAGG - Intergenic
1195240513 X:102947220-102947242 TGCTTCTGGGCTTCTTCCAACGG - Intergenic
1195616937 X:106920093-106920115 GGCTTCAGGGCTGCTAGCCAGGG + Intronic
1198261425 X:134968398-134968420 GGTTTCAGGGCTTCTGCTCAGGG - Intergenic
1198394343 X:136207217-136207239 GCCCTCAGGGCCTCCTCCCTGGG - Intronic