ID: 953038393

View in Genome Browser
Species Human (GRCh38)
Location 3:39233449-39233471
Sequence AGAAATCAAAAGAGACTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953038393_953038403 30 Left 953038393 3:39233449-39233471 CCTGCTAGTCTCTTTTGATTTCT No data
Right 953038403 3:39233502-39233524 GGGTGACATTACCATGTGGATGG No data
953038393_953038397 4 Left 953038393 3:39233449-39233471 CCTGCTAGTCTCTTTTGATTTCT No data
Right 953038397 3:39233476-39233498 TGGGAGATTACAAGAACCCAGGG No data
953038393_953038399 10 Left 953038393 3:39233449-39233471 CCTGCTAGTCTCTTTTGATTTCT No data
Right 953038399 3:39233482-39233504 ATTACAAGAACCCAGGGCATGGG No data
953038393_953038402 26 Left 953038393 3:39233449-39233471 CCTGCTAGTCTCTTTTGATTTCT No data
Right 953038402 3:39233498-39233520 GCATGGGTGACATTACCATGTGG No data
953038393_953038398 9 Left 953038393 3:39233449-39233471 CCTGCTAGTCTCTTTTGATTTCT No data
Right 953038398 3:39233481-39233503 GATTACAAGAACCCAGGGCATGG No data
953038393_953038396 3 Left 953038393 3:39233449-39233471 CCTGCTAGTCTCTTTTGATTTCT No data
Right 953038396 3:39233475-39233497 TTGGGAGATTACAAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953038393 Original CRISPR AGAAATCAAAAGAGACTAGC AGG (reversed) Intergenic
No off target data available for this crispr