ID: 953038403

View in Genome Browser
Species Human (GRCh38)
Location 3:39233502-39233524
Sequence GGGTGACATTACCATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953038393_953038403 30 Left 953038393 3:39233449-39233471 CCTGCTAGTCTCTTTTGATTTCT No data
Right 953038403 3:39233502-39233524 GGGTGACATTACCATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953038403 Original CRISPR GGGTGACATTACCATGTGGA TGG Intergenic
No off target data available for this crispr