ID: 953038977

View in Genome Browser
Species Human (GRCh38)
Location 3:39238007-39238029
Sequence CCAACAACATTGACGCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953038977_953038987 30 Left 953038977 3:39238007-39238029 CCTGAGGGCGTCAATGTTGTTGG No data
Right 953038987 3:39238060-39238082 TCCTTGTGAAGGCTGGTGGAGGG No data
953038977_953038983 19 Left 953038977 3:39238007-39238029 CCTGAGGGCGTCAATGTTGTTGG No data
Right 953038983 3:39238049-39238071 CACTAATGAAGTCCTTGTGAAGG No data
953038977_953038985 26 Left 953038977 3:39238007-39238029 CCTGAGGGCGTCAATGTTGTTGG No data
Right 953038985 3:39238056-39238078 GAAGTCCTTGTGAAGGCTGGTGG No data
953038977_953038982 -8 Left 953038977 3:39238007-39238029 CCTGAGGGCGTCAATGTTGTTGG No data
Right 953038982 3:39238022-39238044 GTTGTTGGGTGATCTGTAAGGGG No data
953038977_953038984 23 Left 953038977 3:39238007-39238029 CCTGAGGGCGTCAATGTTGTTGG No data
Right 953038984 3:39238053-39238075 AATGAAGTCCTTGTGAAGGCTGG No data
953038977_953038980 -10 Left 953038977 3:39238007-39238029 CCTGAGGGCGTCAATGTTGTTGG No data
Right 953038980 3:39238020-39238042 ATGTTGTTGGGTGATCTGTAAGG No data
953038977_953038981 -9 Left 953038977 3:39238007-39238029 CCTGAGGGCGTCAATGTTGTTGG No data
Right 953038981 3:39238021-39238043 TGTTGTTGGGTGATCTGTAAGGG No data
953038977_953038986 29 Left 953038977 3:39238007-39238029 CCTGAGGGCGTCAATGTTGTTGG No data
Right 953038986 3:39238059-39238081 GTCCTTGTGAAGGCTGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953038977 Original CRISPR CCAACAACATTGACGCCCTC AGG (reversed) Intergenic
No off target data available for this crispr