ID: 953038985

View in Genome Browser
Species Human (GRCh38)
Location 3:39238056-39238078
Sequence GAAGTCCTTGTGAAGGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953038976_953038985 27 Left 953038976 3:39238006-39238028 CCCTGAGGGCGTCAATGTTGTTG No data
Right 953038985 3:39238056-39238078 GAAGTCCTTGTGAAGGCTGGTGG No data
953038977_953038985 26 Left 953038977 3:39238007-39238029 CCTGAGGGCGTCAATGTTGTTGG No data
Right 953038985 3:39238056-39238078 GAAGTCCTTGTGAAGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953038985 Original CRISPR GAAGTCCTTGTGAAGGCTGG TGG Intergenic
No off target data available for this crispr