ID: 953039718

View in Genome Browser
Species Human (GRCh38)
Location 3:39244996-39245018
Sequence CAGGACCACCTTAAGTTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953039715_953039718 9 Left 953039715 3:39244964-39244986 CCTTTTTCTGGTACTAGGGTTAC No data
Right 953039718 3:39244996-39245018 CAGGACCACCTTAAGTTATTAGG No data
953039710_953039718 29 Left 953039710 3:39244944-39244966 CCTCCAGAGATTTGGATTTACCT No data
Right 953039718 3:39244996-39245018 CAGGACCACCTTAAGTTATTAGG No data
953039711_953039718 26 Left 953039711 3:39244947-39244969 CCAGAGATTTGGATTTACCTTTT No data
Right 953039718 3:39244996-39245018 CAGGACCACCTTAAGTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953039718 Original CRISPR CAGGACCACCTTAAGTTATT AGG Intergenic
No off target data available for this crispr