ID: 953042186

View in Genome Browser
Species Human (GRCh38)
Location 3:39265405-39265427
Sequence CCTTGTGTCTACAGAGAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953042186_953042190 1 Left 953042186 3:39265405-39265427 CCAGGTTCTCTGTAGACACAAGG 0: 1
1: 0
2: 2
3: 14
4: 157
Right 953042190 3:39265429-39265451 TTTGGGATTCCCTTCAGAGAAGG 0: 1
1: 0
2: 1
3: 12
4: 182
953042186_953042193 28 Left 953042186 3:39265405-39265427 CCAGGTTCTCTGTAGACACAAGG 0: 1
1: 0
2: 2
3: 14
4: 157
Right 953042193 3:39265456-39265478 ATGCATCTCCATCACTCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953042186 Original CRISPR CCTTGTGTCTACAGAGAACC TGG (reversed) Exonic
900716924 1:4150908-4150930 CCTTGTGCTTCCAGAGCACCAGG - Intergenic
900881160 1:5382334-5382356 CCTTGTGTCTGCAGAGTAGAGGG + Intergenic
904688109 1:32274979-32275001 CCTTGTCTTTACAGACAACCTGG + Exonic
905004651 1:34699918-34699940 CCTCGTGTCTTCAGAGTATCAGG - Intergenic
905344003 1:37299176-37299198 TGTTCTGTCTTCAGAGAACCAGG + Intergenic
906776008 1:48530168-48530190 CCATGTGGCTAGTGAGAACCTGG - Intergenic
907731776 1:57073625-57073647 CCTTGTGTTTACACAGTAGCTGG - Intronic
908499610 1:64730064-64730086 CCTTGTGTCCAGAGACAAGCAGG - Intergenic
911305372 1:96225661-96225683 CCTTGTTTCTACAGAGATTGAGG - Intergenic
915493844 1:156267198-156267220 CCTTGTGTCTGCACAGGCCCTGG + Intronic
916914673 1:169393138-169393160 CTTGGTGTCTGCAGAGAACGGGG + Intronic
917174621 1:172219736-172219758 CCTTGTAGCTAGAGAAAACCAGG + Intronic
917453103 1:175163519-175163541 GCTTTTCTCTACAGAGAGCCTGG - Intronic
918945777 1:191062785-191062807 CCTAGTATCTCTAGAGAACCTGG + Intergenic
919921664 1:202169782-202169804 CCCTGTGTCTCCAGATCACCTGG + Intergenic
920047503 1:203142929-203142951 TGTTGTGTTTACAGAGAACAGGG - Intronic
1066110271 10:32189377-32189399 CCCTCTGTCTACAGAGTAGCTGG - Intergenic
1068626394 10:59253111-59253133 CCATGTGCCTACTGAGAACTGGG + Intronic
1069380033 10:67833724-67833746 CCTTGCCTCTACCGAGAGCCTGG - Intronic
1075577435 10:123588289-123588311 CCTTGCATCTTCAGAGAACTTGG - Intergenic
1075578149 10:123595905-123595927 CCATGTGTCTCCAGAGGCCCTGG + Intergenic
1077140248 11:1021045-1021067 CCTTGGGTCTCCAGAGACTCAGG - Intronic
1078319023 11:10317470-10317492 CCTTTTGTTTGCAGAGAACCAGG + Intronic
1078473656 11:11611918-11611940 ATTTGTGTCTACAAGGAACCTGG - Intronic
1078621118 11:12909162-12909184 CATTGTTTCTACAGAGAATGAGG - Intronic
1083063157 11:59895829-59895851 CCATGTGTCTACATATATCCTGG + Intergenic
1087262106 11:96022937-96022959 CTTTGTGTTTAAATAGAACCAGG + Intronic
1087676475 11:101168458-101168480 ACTTGTGTCTAAAATGAACCAGG - Intergenic
1093551754 12:20420750-20420772 GCTTGTATTTTCAGAGAACCCGG - Intronic
1096475388 12:51906548-51906570 CCTTGTGTCAGCAGAGTTCCAGG + Intergenic
1098568896 12:71967227-71967249 CCTTGTGCCTGCAGAGAAGAAGG - Intronic
1102528084 12:113526215-113526237 CTTTGTTTCTACAGAGGACAGGG + Intergenic
1104839636 12:131816690-131816712 CCATGTTTCTACAGTGAGCCTGG - Intergenic
1105242354 13:18619831-18619853 GCTTGTTTTTTCAGAGAACCTGG - Intergenic
1105867500 13:24474027-24474049 TCTTGTGACTACATAGGACCAGG - Intronic
1106075671 13:26458982-26459004 CCTTGTGCCCACACAGAACAAGG - Intergenic
1108728072 13:53202434-53202456 CCGTGTGTCTATAAAGAACCTGG - Intergenic
1112559300 13:100498037-100498059 CCTTGTCTCTACAAAAAAACAGG - Intronic
1112725436 13:102298650-102298672 CCTTGTGTCTAGAGTCCACCAGG - Intronic
1113132516 13:107053867-107053889 CTTTTTGTCTACAGTGGACCTGG - Intergenic
1114408224 14:22476078-22476100 CCTTGTGTAGCCAGAGAACCTGG + Intergenic
1118762796 14:68890761-68890783 CCTGGAGCCTACAGAGACCCCGG + Intronic
1118994469 14:70823376-70823398 CTTTGGGACTACTGAGAACCAGG - Intergenic
1119709232 14:76809338-76809360 CCTTCGGGCTGCAGAGAACCTGG - Exonic
1120727553 14:87962036-87962058 CATTTTGTGTACTGAGAACCTGG + Intronic
1121492576 14:94370620-94370642 GCTTGTGTCTACCAAGACCCTGG + Intergenic
1122901545 14:104784246-104784268 CCTTGTGGCTTCACAGGACCTGG - Intronic
1123036172 14:105472865-105472887 CCGTGTGTCTCCAGGGCACCTGG + Intergenic
1123488947 15:20764761-20764783 GCTTGTTTTTTCAGAGAACCTGG + Intergenic
1123545446 15:21333848-21333870 GCTTGTTTTTTCAGAGAACCTGG + Intergenic
1124255084 15:28134377-28134399 CATTGTTTATGCAGAGAACCTGG - Intronic
1127943454 15:63725358-63725380 CCCTGTGTCTCCAGAGGAACAGG - Exonic
1128732683 15:70031745-70031767 CCTTGTGCCTACAGAGCATCAGG + Intergenic
1131343279 15:91622895-91622917 CATTGTTTCTACAGAAAAGCTGG + Intergenic
1202953791 15_KI270727v1_random:61119-61141 GCTTGTTTTTTCAGAGAACCTGG + Intergenic
1132908469 16:2296536-2296558 CCTTGTCTCTAAAGAGGACATGG - Intronic
1133822272 16:9247311-9247333 CCTTCTGTCTCCATATAACCTGG + Intergenic
1134543452 16:15088889-15088911 CCATGTGCTTAGAGAGAACCAGG + Intronic
1135180206 16:20266866-20266888 GCTTGTGTCTGCACAGAAACTGG - Intergenic
1135361033 16:21815046-21815068 CCATGTGCTTAGAGAGAACCAGG + Intergenic
1136051910 16:27657138-27657160 GCATGTGTCTCCAGAGAACAAGG - Intronic
1136261497 16:29080350-29080372 CCATGTGCTTAGAGAGAACCAGG - Intergenic
1136453474 16:30368075-30368097 CCTTGTGCCTAGAAAGCACCAGG + Intronic
1138826494 16:60326776-60326798 CCTTTTGTCTACAGAAAAAATGG - Intergenic
1139243581 16:65419246-65419268 CCTTGGGTCTACAGAGACCCAGG - Intergenic
1141767403 16:86067763-86067785 CCTTGTGTCTCCAGCTATCCTGG + Intergenic
1142811599 17:2398026-2398048 CCCTGTGCCTGCAGAGCACCTGG - Intronic
1143111616 17:4556045-4556067 CCTTGCAACTACAGAGACCCAGG + Intergenic
1143333662 17:6156949-6156971 CTTTGTGTATACAGATAGCCCGG - Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1146832399 17:36081508-36081530 CCTGGGGTCTGCAGGGAACCAGG - Intergenic
1147177953 17:38668523-38668545 CCCTCTGTCTATGGAGAACCTGG - Intergenic
1148249240 17:46060778-46060800 CCTGATGTCTACAGGAAACCTGG + Intronic
1148486021 17:47991481-47991503 CCCTGTGTCTCCAGAGAAAGGGG - Intergenic
1149376253 17:56047208-56047230 TCCTGTGTCTCCAGATAACCAGG - Intergenic
1149661004 17:58333793-58333815 CCTTGAGTCTAAAGAGAAAGTGG + Intergenic
1150008732 17:61486206-61486228 CCATGTGTTTGGAGAGAACCTGG - Intergenic
1151155115 17:72118577-72118599 ACTTGTGTCTGTAGAGATCCGGG - Intergenic
1151459017 17:74243788-74243810 CCTTGAGGCTAAAGAGACCCAGG - Intronic
1154446595 18:14440047-14440069 GCTTGTGTTTTCAGAGAACCTGG + Intergenic
1154981428 18:21505530-21505552 CCTGGTGTATACTGAGAAGCTGG + Exonic
1156196446 18:34779087-34779109 TGTTCTGTCTACAGAGCACCTGG - Intronic
1156933263 18:42671163-42671185 TCCTGTGTCCACAGAGAACCCGG + Intergenic
1158642795 18:59218128-59218150 CTGTGTGTCTGCAGAGCACCTGG - Intergenic
1160146247 18:76367470-76367492 CCTGGGGTCTAGAGAGCACCAGG - Intronic
1160543963 18:79640704-79640726 CCTTGTGACTGCAGAGTATCAGG + Intergenic
1164477994 19:28590019-28590041 CCTTGTGTCTCCTGTGTACCGGG - Intergenic
1165167656 19:33868402-33868424 CATTGTGTCTCGAGAGAAACAGG - Intergenic
1166987616 19:46670971-46670993 CCCTGTGTCTACAAAAACCCTGG + Intergenic
930120937 2:47760195-47760217 CCTTGTGTTTACTGAAAAGCAGG - Intronic
931119734 2:59202998-59203020 CCTAGTGACAACGGAGAACCTGG - Intergenic
931833102 2:66072680-66072702 CCCTGTTGCTACAGAGAAGCAGG - Intergenic
938391082 2:130906561-130906583 CCTTGTGGATAATGAGAACCAGG - Intronic
938831047 2:135050606-135050628 CCTTGTGTCTATAGTTTACCTGG - Intergenic
940630164 2:156228845-156228867 CCTTTTGGATACAGATAACCTGG - Intergenic
941327523 2:164135453-164135475 GCTTGTGTCTGCAGTGAATCTGG - Intergenic
941671198 2:168294992-168295014 CATTCTGGCAACAGAGAACCAGG + Intergenic
946404809 2:219486672-219486694 CCTTGTTTCTGCAGGGAACGGGG - Intronic
948777541 2:240297493-240297515 CCCTCTGTCTTCAGGGAACCAGG + Intergenic
1170573672 20:17647139-17647161 CTTTGTGTCTAGAGACCACCTGG - Intronic
1170804861 20:19620662-19620684 TCTTGTGTTTACAGAGCAGCTGG + Intronic
1176156713 20:63626122-63626144 CCATGGGTCTACACAGATCCAGG + Intronic
1177079452 21:16620255-16620277 ACATGTGTCTACTGAGAACTTGG + Intergenic
1184296953 22:43530954-43530976 TCTTGTGTCTAGAAAGAAGCCGG - Exonic
950659790 3:14460184-14460206 CCCTGTTTCTACAAAGCACCTGG - Intronic
953042186 3:39265405-39265427 CCTTGTGTCTACAGAGAACCTGG - Exonic
953126751 3:40097737-40097759 ACTTCTGTCTACAGAGACACAGG - Intronic
954050903 3:47976230-47976252 CCTTGTGACAAAAAAGAACCTGG - Intronic
955643854 3:61115331-61115353 CACTGTGTCTAGAGAGAGCCTGG + Intronic
959610045 3:108283424-108283446 CCTGGTTTCTACGGAGAACTAGG + Intergenic
961359912 3:126360559-126360581 CCTCTTGTCTACACAGCACCAGG - Intergenic
961458659 3:127036726-127036748 CCCTGTGTCTGCAGGGAGCCAGG + Exonic
962501664 3:136000278-136000300 CCTAGTGTATACAAAGAACCTGG + Intronic
962956363 3:140270599-140270621 CCTCCTGTCTACACACAACCAGG - Intronic
963783069 3:149506694-149506716 TCTTTAATCTACAGAGAACCAGG + Intergenic
965610260 3:170536014-170536036 CGCTGTGTCTACAGAGATACTGG + Intronic
970564761 4:17320980-17321002 CATGGTGTCTACACAGTACCTGG + Intergenic
971425297 4:26509641-26509663 TGTTGTGTGTACAGAGAACCAGG + Intergenic
973833245 4:54783048-54783070 CATTGTGTCTGCTGAGAATCTGG - Intergenic
975067676 4:70088529-70088551 CCTTGTGTTGACAGATAAGCAGG - Intergenic
975657397 4:76655304-76655326 CACTGTGTCTAAAGAGAACATGG - Intronic
977459371 4:97306078-97306100 CCTTGTGGCTGCAGAAAACTGGG - Intronic
977731807 4:100362826-100362848 CATTGTGTATACAGAGCACTAGG - Intergenic
977794161 4:101142572-101142594 CCCTGTGTCTACAAAAAAGCTGG - Intronic
980686945 4:136240911-136240933 GCTGGTGGCTACAGAGAAGCTGG + Intergenic
981327665 4:143469104-143469126 CCTTGGCTCTAAAGAGTACCCGG + Exonic
982207671 4:153009167-153009189 CATTCTGTCTCCAGACAACCAGG + Intergenic
983562701 4:169116834-169116856 CCTTGAGTCTACTGAGTGCCTGG + Intronic
983712606 4:170737939-170737961 CTTTGTGCCTGCAGAAAACCTGG - Intergenic
983926780 4:173411299-173411321 CCTTGTGGCTACAAAGATTCAGG + Intergenic
984046662 4:174808727-174808749 GCCTGTGCCTACAGAGAATCAGG - Intronic
984196400 4:176662838-176662860 CTCTGTGTCTACAGATATCCTGG + Intergenic
987833565 5:23131117-23131139 CCTTGTTTCTTCAGAGAAATTGG - Intergenic
989493832 5:42088588-42088610 CTTTGTGTCCACACAGTACCAGG - Intergenic
993045660 5:82863396-82863418 CCTTGTTTCCACAGAGACCAGGG + Intergenic
993094362 5:83464539-83464561 CCTTGTTTCTTCAGAAATCCTGG + Intergenic
993890802 5:93469476-93469498 TTCTGTGTATACAGAGAACCCGG + Intergenic
1000073551 5:157763779-157763801 CCTGGCTTCTAGAGAGAACCAGG + Intergenic
1001326540 5:170732149-170732171 CCTGGTTTCTACAGAGACCCAGG - Intronic
1003488409 6:6599623-6599645 CTTTGTGCCTGCAGAGCACCAGG - Intronic
1004714284 6:18202224-18202246 CCTTGTGTCTACAAAAAAAAAGG + Intronic
1006367358 6:33623219-33623241 CCTAGTGTCTGAAGAGCACCAGG + Intronic
1006976823 6:38110190-38110212 CATTGTGTGGACAGAGAACAAGG - Intronic
1007365491 6:41389025-41389047 CCTATTGGCTACAGAAAACCTGG + Intergenic
1009640202 6:66325556-66325578 CTTTGTGACTTCAGACAACCTGG + Intergenic
1015214641 6:130735566-130735588 CCTTCTGTCTATAAAGAACCAGG + Intergenic
1016800873 6:148167815-148167837 CCTTATGTCTACAGAGAAACTGG - Intergenic
1018657083 6:166047587-166047609 CCTTGTGTCAAGAGACAAGCAGG - Intergenic
1019334002 7:474319-474341 CCTTTTGTCAACAGAGCACAGGG + Intergenic
1019497359 7:1346703-1346725 CCTTGGGTCTCCAAAGACCCAGG + Intergenic
1020420557 7:7999602-7999624 CCCTGTGTCTAAAAAGAACAAGG + Intronic
1022544926 7:31177589-31177611 CCCTGTGTTTACAGAGAGCTTGG + Intergenic
1024580285 7:50795368-50795390 ACTGATGTCTACAGAGAGCCAGG - Intergenic
1028387058 7:90267421-90267443 CCTTGGGCATTCAGAGAACCTGG + Intronic
1028933728 7:96442750-96442772 CCTTGTACCAACAGAGCACCAGG - Intergenic
1029652988 7:101906455-101906477 CCTAGTGTCCCCAGAGAACAGGG - Intronic
1031487110 7:122340628-122340650 CCATGTGTCAGCAGAGATCCTGG - Intronic
1037333128 8:17764252-17764274 CCTTGGGGATACAGAGAATCAGG + Intronic
1039334351 8:36573642-36573664 TCTTGAGTCTAAAGACAACCTGG - Intergenic
1039826573 8:41179359-41179381 CCTTGGGTTTACACAGAACTGGG + Intergenic
1042220435 8:66467933-66467955 CTCTGTGTGTACAGAGAACCTGG + Intronic
1048738246 8:137525814-137525836 CCAAGTGTCTACAGAGTCCCTGG - Intergenic
1055139251 9:72856880-72856902 TCTGGTGTCTAAAGAGAAGCTGG + Intergenic
1059584584 9:115592179-115592201 CTTTGTGTCTATAAAGACCCAGG - Intergenic
1059590752 9:115658454-115658476 CCTTGTGTGTATACAGAACTGGG + Intergenic
1059719625 9:116946796-116946818 CCTTTGGTCTACAGAGATCCTGG - Intronic
1187920980 X:24201475-24201497 CCTTGTGTTTACAAAGAACAGGG - Intronic
1188849355 X:35112823-35112845 ACTTATGTCTACTGAAAACCTGG - Intergenic
1190776762 X:53558875-53558897 GCTTGTAGCCACAGAGAACCAGG + Intronic
1191852342 X:65594691-65594713 CCTGGTTTCTACAGTGAATCAGG + Intronic
1192950545 X:76011717-76011739 CTATGGGTCAACAGAGAACCAGG + Intergenic
1193945788 X:87732286-87732308 CATTCTGTCATCAGAGAACCAGG - Intergenic
1195588521 X:106596762-106596784 CCTTGAGGCTACAGAGAAAAGGG + Intergenic
1196464404 X:115958178-115958200 CCTTGGGCCTCCAGAGAGCCTGG + Intergenic