ID: 953043730

View in Genome Browser
Species Human (GRCh38)
Location 3:39277506-39277528
Sequence ATGGAGGAGCTGAACAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 395}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953043730_953043737 5 Left 953043730 3:39277506-39277528 CCCTCCTTGTTCAGCTCCTCCAT 0: 1
1: 0
2: 5
3: 33
4: 395
Right 953043737 3:39277534-39277556 GTGCTGGTTCCAAACGTCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 71
953043730_953043741 20 Left 953043730 3:39277506-39277528 CCCTCCTTGTTCAGCTCCTCCAT 0: 1
1: 0
2: 5
3: 33
4: 395
Right 953043741 3:39277549-39277571 GTCTCTGGACTCAGGATACTGGG 0: 1
1: 0
2: 2
3: 12
4: 203
953043730_953043738 12 Left 953043730 3:39277506-39277528 CCCTCCTTGTTCAGCTCCTCCAT 0: 1
1: 0
2: 5
3: 33
4: 395
Right 953043738 3:39277541-39277563 TTCCAAACGTCTCTGGACTCAGG 0: 1
1: 0
2: 1
3: 14
4: 96
953043730_953043740 19 Left 953043730 3:39277506-39277528 CCCTCCTTGTTCAGCTCCTCCAT 0: 1
1: 0
2: 5
3: 33
4: 395
Right 953043740 3:39277548-39277570 CGTCTCTGGACTCAGGATACTGG 0: 1
1: 0
2: 0
3: 10
4: 82
953043730_953043742 27 Left 953043730 3:39277506-39277528 CCCTCCTTGTTCAGCTCCTCCAT 0: 1
1: 0
2: 5
3: 33
4: 395
Right 953043742 3:39277556-39277578 GACTCAGGATACTGGGTCAGAGG 0: 1
1: 0
2: 0
3: 14
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953043730 Original CRISPR ATGGAGGAGCTGAACAAGGA GGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900287983 1:1910886-1910908 AGGCAGAAGCTGCACAAGGAAGG + Intergenic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900622536 1:3593869-3593891 AGGGAGGAGAGTAACAAGGAAGG - Intronic
900770763 1:4541863-4541885 TTGAAAGAGCTGAACAAGAATGG + Intergenic
900828490 1:4946080-4946102 GTGGAGGAACTGAACAAGCAAGG + Intergenic
901239965 1:7687221-7687243 GAGGAGGAGCTGGCCAAGGAGGG + Intronic
901241075 1:7693821-7693843 CTGGAGGAGCTGGAGAGGGAGGG - Intronic
901400240 1:9010751-9010773 ATGAATGACCAGAACAAGGAAGG - Intronic
901881355 1:12195688-12195710 ATGGAGGAGGAGGACAAGGGAGG + Intronic
902105516 1:14032671-14032693 TTGGAAGAGCTGAGCCAGGATGG - Intergenic
903224926 1:21889094-21889116 ATTGAGGTGCGGAACAAGGGAGG + Intronic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904304958 1:29582702-29582724 ATGGAGGGTGTGAGCAAGGAAGG - Intergenic
904398797 1:30242001-30242023 ATGGAGGGTGTGAGCAAGGAAGG + Intergenic
905436124 1:37956410-37956432 AGGGATGGGCTGAACTAGGAAGG + Intergenic
905878356 1:41447931-41447953 AAGGAGGAGTTTATCAAGGAGGG + Intergenic
905898305 1:41563427-41563449 AGGGAGGAGGGGAAGAAGGAGGG - Intronic
906726913 1:48050917-48050939 ATGGAGGCACTGGACAAGGTAGG - Intergenic
906858551 1:49333795-49333817 ATGGCCAAACTGAACAAGGAGGG - Intronic
907201044 1:52726826-52726848 AAGGAGGAGCTGAACACCGAGGG - Intronic
908385835 1:63640750-63640772 ATGGACGGCCTGAAGAAGGAAGG - Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
910990763 1:93053554-93053576 ATTGAGAAGGTGAAAAAGGAAGG - Intergenic
911459664 1:98173590-98173612 CTGCAGGAGCTGACCAAGGAAGG - Intergenic
911992706 1:104722377-104722399 ATGGAGGGGGGGAACAAAGAAGG - Intergenic
912069557 1:105792708-105792730 TAGGAGGAGGTGAAAAAGGAAGG - Intergenic
912734221 1:112135729-112135751 ATGCAGGAGCTGAACCATGGAGG + Intergenic
913502967 1:119488768-119488790 AGGCTGGAGCTGCACAAGGAAGG + Intergenic
914943383 1:152042428-152042450 AAAGAGGAGCTGAACCAGAATGG + Intronic
915074853 1:153299582-153299604 CAGGAGGAGGAGAACAAGGAGGG - Intronic
915147483 1:153803615-153803637 ATGGCAGAGCTGGATAAGGAGGG - Intergenic
915989523 1:160499731-160499753 TAGGAGGAGCTGAATAGGGAAGG + Intronic
916016653 1:160755665-160755687 AGGAAGGAGCTGAAGAGGGAGGG + Intergenic
917521429 1:175751127-175751149 AGGGAGGAGCAGAACCAGGCTGG - Intergenic
917604853 1:176616668-176616690 ATAGAGGAGCTTAAGAAGTATGG - Intronic
918375377 1:183903794-183903816 ATAGAGGAGCTAAACAAAGCTGG + Intronic
919078965 1:192847242-192847264 AGGGAGGAGCCGAGAAAGGAGGG + Intergenic
920657337 1:207886767-207886789 ATGGGGGTGCAGAGCAAGGAAGG + Exonic
920984651 1:210875024-210875046 AAGGAGGAAATGAAAAAGGAAGG + Intronic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
922980634 1:229823526-229823548 ATGGAAGAGATGCACAAGGCAGG - Intergenic
1063009026 10:2004352-2004374 AGGGAGAAGCTGAACAGTGATGG + Intergenic
1063969849 10:11373915-11373937 AAGGAGGATCTGAACAAAGGAGG - Intergenic
1064473202 10:15658452-15658474 ATGTAGGAGCTGAGGACGGAGGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1067539537 10:47141741-47141763 ATGGAGGAAGTAGACAAGGAGGG + Intergenic
1067968496 10:50942045-50942067 TGGGAGGACCTGAAGAAGGAGGG - Intergenic
1069358019 10:67610169-67610191 ATGGAGGATCTGAACAATAGAGG - Intronic
1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070395970 10:76011498-76011520 ATGGAGGAACTGAGGATGGAGGG - Intronic
1072244873 10:93534501-93534523 ATGGAGGGGTTGAACAAGGCAGG - Intergenic
1072807175 10:98430968-98430990 ATGGGTGAGCTGAAAAAGGTTGG + Intronic
1073064773 10:100751460-100751482 GTAGAGGAGCTGGACAAGGAGGG + Intronic
1073625216 10:105089815-105089837 ATGGAGGTGCGGACCACGGATGG + Exonic
1074003109 10:109392155-109392177 ATGAATGAGCTGAAGAAGAATGG + Intergenic
1074673102 10:115818053-115818075 ATGGAGCAGCTAAAAGAGGAGGG - Intronic
1074835410 10:117287655-117287677 CAGGAGGATCTGAACAGGGAAGG - Intronic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075236631 10:120736675-120736697 AGGGAGGAGCTGATCAGGCAGGG - Intergenic
1075289117 10:121213326-121213348 GTGGAGGAAATGAAAAAGGAAGG + Intergenic
1076174705 10:128359180-128359202 AGGGATGAGCTGATCCAGGAAGG + Intergenic
1076809429 10:132878940-132878962 TAGGAGGAGCAGGACAAGGAGGG + Intronic
1076934106 10:133555980-133556002 AAGGAGCAGCTGCTCAAGGAAGG - Exonic
1077093778 11:790894-790916 ATGCAGAGGCTGAAAAAGGAGGG + Exonic
1078652952 11:13212953-13212975 TTGGAGGAGCTTCACAGGGAAGG + Intergenic
1078899638 11:15629609-15629631 ATGGAGGCACTGAACAGAGATGG + Intergenic
1079242891 11:18733230-18733252 ATCGAGGAGATGAACGAGGTAGG - Exonic
1080895766 11:36447833-36447855 ATGGAAGAGATGGAGAAGGAGGG + Intronic
1081697031 11:45119858-45119880 AAGTAGGAGATGAGCAAGGAAGG + Intronic
1082820401 11:57541037-57541059 CTGGAGCCGCTGAACCAGGAAGG + Intergenic
1083176475 11:60952908-60952930 AGGGAGGAGCTTAGCATGGAAGG - Intergenic
1083476032 11:62916226-62916248 ATGGAGGAGTTGGACAAGCCTGG + Intronic
1083541357 11:63513743-63513765 AGGGATGAGGTGAAGAAGGAGGG - Intronic
1084157696 11:67323365-67323387 ATGGAGGAGCTGTTCTTGGAAGG + Intronic
1084617491 11:70246245-70246267 ATGGGGCAGCTGAGCCAGGAAGG - Intergenic
1085420480 11:76354084-76354106 AAGGGGGACATGAACAAGGAGGG + Intronic
1086099014 11:83079611-83079633 AGGGAGCAGTTGAACAAGCATGG + Intergenic
1087274881 11:96151189-96151211 AGGCAGGAGCTGAGGAAGGATGG - Intronic
1088011896 11:105013790-105013812 ATGGAGGAGCAAATGAAGGATGG - Intronic
1088028532 11:105217275-105217297 AGGGAGGAGTTGAACTGGGAAGG + Intergenic
1088727956 11:112656225-112656247 AGGGAGGAGCTGAGCCCGGAAGG - Intergenic
1088994852 11:114987392-114987414 ATGGAGGAGTGGTTCAAGGAAGG + Intergenic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1090276379 11:125422623-125422645 ATGGAGGCGCTGAAAAGGGAAGG + Intronic
1091054869 11:132408459-132408481 GTGAGGGAGCTGAGCAAGGATGG - Intergenic
1091396079 12:154967-154989 CTGGAGGAGGTGAACCAGCATGG - Intronic
1091893907 12:4084824-4084846 CTGGAGGAGCTGTCCAAGGCCGG + Intergenic
1093262525 12:16956962-16956984 ATGAAGGAAGTGAAAAAGGAAGG - Intergenic
1093661779 12:21765888-21765910 TTGGAGGGTCTGAATAAGGATGG + Exonic
1094246924 12:28308858-28308880 ATGAAGGAAAAGAACAAGGATGG - Intronic
1094395270 12:29998722-29998744 ATTGAGGATCTGAGGAAGGAAGG + Intergenic
1094771246 12:33662706-33662728 AGGGAGAAGCTGAGCAAGTAAGG + Intergenic
1096683143 12:53270176-53270198 AGAGAGCAGCTTAACAAGGAGGG - Intronic
1097046224 12:56189439-56189461 ATGGCGGTGCGGAAGAAGGACGG - Exonic
1097046829 12:56193194-56193216 ATGGAGGATCTGGACCAAGAAGG + Intergenic
1097311566 12:58124542-58124564 AAGTGGGAGCTGAACAATGAGGG - Intergenic
1097470292 12:59982516-59982538 ATGGAGCAGCTGTGCAAGCATGG + Intergenic
1101051733 12:100870750-100870772 ATGCAGGAGCTGTTCAAGGCAGG + Intronic
1101545447 12:105707833-105707855 ATGGAGCAGATAAACATGGAAGG + Intergenic
1102133957 12:110557030-110557052 AGGGAGAAGCTGAAAAATGAAGG + Intronic
1102245629 12:111353914-111353936 TGGGAGGAGCTAAACTAGGAGGG - Intergenic
1103662074 12:122528236-122528258 AGTGAGGAGATGAAGAAGGAGGG - Intronic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104896682 12:132168273-132168295 CTGGAGGAGATGAACAAGCTGGG + Intergenic
1105544856 13:21343963-21343985 AGGGAGGAGATGGAGAAGGAGGG - Intergenic
1105646157 13:22320043-22320065 ATGGAGTAGCAGAACAATTAAGG - Intergenic
1105900860 13:24752058-24752080 ATTGAAGTGCTGAACAATGATGG - Intergenic
1107340925 13:39404750-39404772 AGGGAGGATCAGAACAAAGATGG - Intronic
1108379139 13:49840120-49840142 ATGGAGGGAGAGAACAAGGAAGG + Intergenic
1108572833 13:51767820-51767842 CTGGAGGAGCTGAGAAAGGGAGG + Intergenic
1110369396 13:74722921-74722943 ATGCATGAGCTGAACCGGGATGG + Intergenic
1111076792 13:83248023-83248045 AAGAAGAAGCTGAACAAGGAAGG - Intergenic
1112292681 13:98158881-98158903 CTGGAGGAGCTAGACAGGGATGG + Intronic
1112687574 13:101849040-101849062 CTGGAAGAACTGAGCAAGGAAGG - Intronic
1113136931 13:107101176-107101198 ATGGAGGAGGGGAAGAAAGATGG - Intergenic
1113500103 13:110766467-110766489 ATGTAGGAGATGACCAAGTATGG + Intergenic
1113935226 13:113990381-113990403 TAGGAGGAGCTGAGCAAGGTTGG + Intronic
1115912775 14:38274925-38274947 ATGGAGGTGGAGAACAAAGAGGG + Intergenic
1116428086 14:44814567-44814589 AAGTAGGAGCTTAATAAGGAAGG + Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1117521544 14:56556572-56556594 ATGGTGGAGATGAACAAAAATGG - Intronic
1119024922 14:71144925-71144947 ATGGAAGAGCTGCATAGGGAGGG - Intergenic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119694119 14:76699000-76699022 GTAGAAGAGCTGAATAAGGAAGG + Intergenic
1120401225 14:84034629-84034651 AAGAAGGAGCTGAGCAAGGTGGG + Intergenic
1120749594 14:88185848-88185870 CCGGAGCAGCTGAACAAGCATGG - Exonic
1122609792 14:102974011-102974033 AAGGAGGAGCTGCACAAGGTAGG - Exonic
1122690518 14:103529994-103530016 TACGAGGAGCTGATCAAGGAGGG + Exonic
1123068725 14:105630717-105630739 AGAGAGGAGCTGGGCAAGGACGG + Intergenic
1124504566 15:30261861-30261883 TTGGAAGAGGTGAAGAAGGAAGG - Intergenic
1124738986 15:32276774-32276796 TTGGAAGAGGTGAAGAAGGAAGG + Intergenic
1124910947 15:33919996-33920018 ATGGAGGAGATGGATAGGGAAGG - Intronic
1125492867 15:40161221-40161243 ATGGCGGCGGTGAAGAAGGAAGG + Exonic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128798608 15:70482401-70482423 TGGGTGGAACTGAACAAGGAGGG + Intergenic
1130078376 15:80709700-80709722 GTGGAGGAGGAGAACAATGAGGG - Intronic
1130127420 15:81105381-81105403 ATGGAGGAAGGGAAGAAGGAAGG - Intronic
1131233775 15:90679195-90679217 TTGGGGCAGCTGAACAAGGAAGG - Intergenic
1131266289 15:90917371-90917393 AGGAAAGAGCTGAGCAAGGAGGG + Intronic
1131266471 15:90918437-90918459 AGGAAGGAGCTGAGCAGGGAGGG - Intronic
1131395464 15:92082109-92082131 GAGGAGGAGGTGAACAGGGAAGG - Intronic
1131510398 15:93046727-93046749 ATGGAGGAGGGGAACAGGAAAGG + Intronic
1132940774 16:2507061-2507083 CTGGAGGAACTGGACAGGGAGGG - Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134904954 16:17972244-17972266 AAGGAGGAGCTGAGCAAGGATGG - Intergenic
1135177330 16:20242237-20242259 ATGAATGAGCTGAAAATGGAAGG - Intergenic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1136341959 16:29649907-29649929 TTGCTGGAGCTGAAGAAGGAAGG + Intergenic
1136470208 16:30474503-30474525 ATGGAAGTGCAGAACAGGGAAGG + Intronic
1136683955 16:31983407-31983429 ATGGAGGAGGTGCCCCAGGAGGG - Intergenic
1136784581 16:32926959-32926981 ATGGAGGAGGTGCCCCAGGAGGG - Intergenic
1136885202 16:33926847-33926869 ATGGAGGAGGTGCCCCAGGAGGG + Intergenic
1138200468 16:55084528-55084550 ATGGCAGAGTGGAACAAGGAAGG - Intergenic
1138348673 16:56335091-56335113 AGGGAGGATTTGGACAAGGAGGG + Intronic
1139657474 16:68397728-68397750 GAGGAGGAGCTGACCAAGCAAGG - Intronic
1140696919 16:77543874-77543896 AAGGAGGCACTGAACAATGAAGG + Intergenic
1140948089 16:79789649-79789671 ATGGATGAGCTAAACCAGAATGG - Intergenic
1141833702 16:86524306-86524328 AGGGAGGAGCTGAGAAAGGTGGG + Intergenic
1142028272 16:87825809-87825831 ATGGGGGATGTGAACAAGGCTGG - Intergenic
1142196216 16:88740435-88740457 ATGGAGGGGCTGACGAGGGAGGG + Intronic
1203087240 16_KI270728v1_random:1190965-1190987 ATGGAGGAGGTGCCCCAGGAGGG - Intergenic
1142782772 17:2194115-2194137 CTGGAAGAGATGAACAATGATGG + Intronic
1142905048 17:3035719-3035741 AGGGAGGAGGAGAACAAGGATGG + Exonic
1143038649 17:4016242-4016264 ATGGAGGGGCTGAGCACGGAGGG + Intronic
1143272807 17:5688416-5688438 ATGGAGGAACTTAACCTGGAAGG + Intergenic
1143331875 17:6143371-6143393 ATGGAGGAGCTAGAGATGGATGG - Intergenic
1143703533 17:8680309-8680331 GTGGTGCAGCTGAACAAGGATGG + Intergenic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144765938 17:17732493-17732515 ATAGAGGAGATGCCCAAGGAAGG - Intronic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1146953161 17:36920616-36920638 AGGGAGGAACTGGAGAAGGAAGG - Intergenic
1147144880 17:38479110-38479132 ATGGAGGAGGTGCCCCAGGAGGG - Intronic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147364337 17:39950651-39950673 ATGGAGATGCTGAAGAAGGGGGG + Intergenic
1147515533 17:41114272-41114294 AAAGCGGAGCTGAAAAAGGATGG - Intergenic
1147674397 17:42194537-42194559 AGGGAGGAGCTGAAGGAGGGGGG + Intergenic
1148208659 17:45795055-45795077 CTGGAGGAGCTGACCCAGCAGGG + Intronic
1148791673 17:50176736-50176758 CTGGAGGAGCTCAGCAAGGCGGG - Intergenic
1149521403 17:57320968-57320990 AGGTAGGAGGGGAACAAGGAGGG - Intronic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152054966 17:78017405-78017427 GTGGCGGAGCTGAACAAGGAGGG + Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152309859 17:79543572-79543594 AAGGAGGAGCTGATGAAGGGGGG - Intergenic
1152349809 17:79778236-79778258 ATGGAGGAGCTGAGCAGCGTGGG + Exonic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1152896577 17:82914686-82914708 GGGAAGGAGCTGCACAAGGAGGG - Intronic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1157619931 18:49011196-49011218 TTGGAGGGGCTTAACCAGGAGGG + Intergenic
1157728412 18:49983277-49983299 ATGGAGGACCAGAACCAGAAAGG - Intronic
1158639821 18:59194237-59194259 ATGGAGGAAGTGAAGAAGGCAGG - Intergenic
1159367203 18:67483739-67483761 CTTGAGAAGCTGAAAAAGGAAGG - Intergenic
1160628795 18:80231112-80231134 ATGGAGGGAATGGACAAGGATGG + Intronic
1161918332 19:7247399-7247421 ATCGAGAAGAGGAACAAGGAAGG - Intronic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1161958008 19:7506885-7506907 AGGGAGGAGCCAAAGAAGGAGGG - Intronic
1162026988 19:7900047-7900069 TTGGAGGAGCTGCACCTGGAGGG + Exonic
1162805612 19:13136564-13136586 ATGGAGGAGCTGATACAGCAAGG + Intronic
1163487136 19:17594660-17594682 ATGGAGGAGTGGAGCATGGAAGG - Intergenic
1164588640 19:29494333-29494355 ATGGAGGAAGGGAAGAAGGAAGG + Intergenic
1164740936 19:30575291-30575313 ATGGAGGGGCTGTCCATGGAGGG - Intronic
1164915216 19:32046627-32046649 CTGGAGGAGGTGAACCAAGAGGG - Intergenic
1165307997 19:35013818-35013840 ATGGAGGAACAGGACAGGGAGGG + Intronic
1165308656 19:35017696-35017718 AAGGAGGAACTGAGGAAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167050103 19:47072646-47072668 GTGGAGGAACTGAAGAAGCAGGG - Exonic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1168116423 19:54223373-54223395 ATGGACGAGCTGAAGGAGGGAGG - Intronic
1168646447 19:58062004-58062026 AGGGAGGTGTTGAAGAAGGAGGG - Intronic
1168719629 19:58547859-58547881 ATGAAGGAGCTGAATAAGCGGGG + Exonic
925743574 2:7026797-7026819 AGGGTGGAGCTGGACAGGGAGGG - Intronic
926829035 2:16940169-16940191 ATGGTGGAGCTGAAGAAAGAGGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
929031340 2:37652353-37652375 AAGGAGGAGCTAAACAGGAAAGG + Intronic
929794079 2:45045435-45045457 AGGGAGGAGAGGAAGAAGGAAGG - Intergenic
930449069 2:51511265-51511287 ATGGAGCAGCTGAACAGAGAGGG - Intergenic
931196461 2:60056474-60056496 CTGGAGGTGCTGAAAAAGTAGGG + Intergenic
931899211 2:66769378-66769400 AGGGAGGAGGTGAACAAGGAAGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
936021901 2:109001487-109001509 AGAGAGGAGCTGGACAAGAAGGG + Intergenic
936717319 2:115203091-115203113 AAGGAAGAGATGAATAAGGAAGG + Intronic
937332181 2:121038506-121038528 ATGAAGAAGCTGGACAAGGAAGG + Intergenic
937528688 2:122802268-122802290 TTGGAGTAGCTGGACCAGGAGGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938238441 2:129724455-129724477 CTGGTGGAGGTGAACAATGAGGG - Intergenic
938945241 2:136206572-136206594 GTGGAGGAGCTGAGCATGGTAGG + Intergenic
939581178 2:143947851-143947873 CAGGAGGAGGTGAAGAAGGAAGG + Intronic
940063690 2:149601664-149601686 ATGAAGGAGCTGCACAAAAAAGG - Intergenic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
942089398 2:172474243-172474265 GTGGTGGACCTCAACAAGGATGG + Exonic
942229338 2:173845139-173845161 ATGAGGTAGCTGAACCAGGATGG - Intergenic
946020927 2:216639453-216639475 AAGGAGGAGCAGAACAAAAAGGG + Intronic
946321118 2:218955145-218955167 ATGTAGGAGCAGATCAAGAAGGG - Intergenic
947911537 2:233803948-233803970 AGGGAGGAGCTGGACAAGATCGG - Intronic
948068087 2:235097119-235097141 ATGGAGAGGCTGAGCAGGGAGGG + Intergenic
1168949279 20:1785494-1785516 ATGGAGCAAGTGGACAAGGAAGG - Intergenic
1168958207 20:1849341-1849363 ATAGTGCAGCTGAATAAGGAGGG - Intergenic
1169060196 20:2655446-2655468 CTGGAGGAGCTGACAATGGATGG + Exonic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169897775 20:10522733-10522755 ATGGCGGGGAAGAACAAGGAGGG - Intronic
1171495572 20:25552744-25552766 ATAGAGGTGCTGAACAGGGATGG + Intronic
1172517941 20:35548618-35548640 ATGCAGGAGCAGAAGAATGAAGG + Exonic
1172883841 20:38218412-38218434 GTGGGGGAGCTGGACAAGGGAGG - Intronic
1173053942 20:39593034-39593056 ATGGAGTAGCTGCAGAATGAAGG + Intergenic
1173185034 20:40834024-40834046 ATGGAGGAGGTGAAGAGAGAGGG + Intergenic
1173256577 20:41398169-41398191 ATGGGGGAGCTGACTAGGGAGGG - Intergenic
1173556186 20:43967526-43967548 GTGGACGAGATGAACATGGATGG - Intronic
1174112226 20:48204782-48204804 ATGGTGGAGCTGGACCAGGGTGG + Intergenic
1174149495 20:48476155-48476177 ATGGAGGTGCTGACCCAGGGAGG - Intergenic
1174942165 20:54941040-54941062 AGGAAGGAGCTGAAGAAGGGAGG + Intergenic
1175277547 20:57782560-57782582 ATGGTGGAGCTCAGGAAGGAAGG - Intergenic
1175485003 20:59339476-59339498 ATGGAGGAGAGGGACAAGGAAGG + Intergenic
1175753982 20:61517671-61517693 ATGGAGGGAATGAACAAGGAGGG + Intronic
1177471627 21:21567143-21567165 ATGGACAGGCTGAACAAAGAAGG + Intergenic
1178250150 21:30996089-30996111 AAGGAGGAACCGAAAAAGGAAGG + Intergenic
1178480159 21:32973540-32973562 ATGGTGGGGCTGAGAAAGGAAGG - Intergenic
1179380138 21:40890870-40890892 ATCATGGAGCTGAACAAGCAGGG - Intergenic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1179798101 21:43797519-43797541 CTGGAGGAGCTGACCAAAGTGGG + Exonic
1180592938 22:16956206-16956228 ATGAAGAAGGTGAACAAGAAGGG + Intergenic
1181868301 22:25876895-25876917 AAGGAGGAGCTCCACAAGAATGG - Intronic
1182550563 22:31098809-31098831 ATTGAGAAGCTGGAGAAGGAGGG + Exonic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183266054 22:36826299-36826321 ATAGAGGAGCTAAACAGGGCCGG + Intergenic
1183424895 22:37734225-37734247 AGGGAGGAGCTGACCCCGGAGGG + Intronic
1184030434 22:41891205-41891227 GTTGAGGAGCTGAGCAGGGAGGG - Intronic
949329742 3:2908491-2908513 AAGGAGGAACCAAACAAGGATGG + Intronic
949952155 3:9238224-9238246 ATGGAGGAGATGGAGAAGGAAGG + Intronic
950000613 3:9653252-9653274 ATGGGGAAGCTGACCAATGAAGG + Intronic
950590621 3:13933709-13933731 ATGGAGTAGCTGTAGAAGGGGGG + Intergenic
950704902 3:14773530-14773552 AGGGAGGAGGGGAACAAGTAAGG + Intergenic
950711802 3:14818526-14818548 ATGGAGTAGCTGTAGAAGGGGGG + Intergenic
950907621 3:16553392-16553414 ATGGAGTAGCCAAACACGGATGG + Intergenic
951455505 3:22887859-22887881 ATGGAGGAGCTGTTGAAGGCTGG - Intergenic
952184465 3:30953793-30953815 TTGGAGGAGCAGAGCAGGGAAGG + Intergenic
952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG + Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953094481 3:39761508-39761530 TTAGAGGAGCTGAACAGAGAAGG + Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
954701124 3:52451426-52451448 ATCGAGGAGCTCATGAAGGACGG - Exonic
954847380 3:53571601-53571623 GTGGGGGAGCTGGAAAAGGATGG + Intronic
954972750 3:54664793-54664815 TTGCAGGAGCTCAGCAAGGAGGG + Intronic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
955232351 3:57110257-57110279 CTGGAGGAGCTGAAGTCGGAGGG - Exonic
955621866 3:60873102-60873124 TTGGAGGAGGGGAACAAGGCAGG + Intronic
955932629 3:64072944-64072966 ATAGAACAGCTGAACTAGGAAGG - Intergenic
957307174 3:78472701-78472723 TTGGGGGAGCTGAACCAAGATGG + Intergenic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
961109172 3:124269016-124269038 GTGGAGGAGCTGGACCGGGAGGG + Exonic
961688380 3:128650903-128650925 ATGGCGGCGCCGAACAAGGAAGG + Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962384299 3:134920638-134920660 ATGGAGGAGCTGTAAAAAGAGGG + Intronic
962493992 3:135921399-135921421 TAGGAGGAGCTGACCAAGTAAGG - Intergenic
964977038 3:162634266-162634288 AGGGAGGAGGTGAACTTGGAGGG - Intergenic
965939559 3:174161968-174161990 TTGGAAGAGCTTAACATGGATGG + Intronic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967679182 3:192339663-192339685 ATGGGGGAGTTCAACAAGGTAGG - Intronic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
974322019 4:60362868-60362890 ATTGAGGAGCTAAACAGTGATGG - Intergenic
975618619 4:76273206-76273228 CTGGAGGAATGGAACAAGGATGG + Intronic
976212984 4:82690959-82690981 ATAAAGGAGCTGAACAAAGGAGG + Intronic
977293911 4:95191711-95191733 AGGGAGGAGGTGAGCAGGGAAGG - Intronic
977294094 4:95192454-95192476 GGGGAGGAGGTGAACAGGGAAGG - Intronic
977416891 4:96744246-96744268 AAGGAGGAGGAGAACAAAGAGGG - Intergenic
978912686 4:114082977-114082999 ATGGAGGAGCCCAAGAATGAAGG + Intergenic
980835517 4:138187141-138187163 TTGGAGGAGCTGGACTGGGAAGG - Intronic
981957626 4:150498405-150498427 ATGAAGGAGAAGAACAAAGAAGG + Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
989519824 5:42388546-42388568 GTGGAGGAGCTGGAGAAGAATGG - Intergenic
990803087 5:59627812-59627834 AGGCAGAGGCTGAACAAGGATGG + Intronic
991260555 5:64663133-64663155 GTGGTGGAGGTGAACAATGAAGG + Intergenic
991927435 5:71719194-71719216 AGGGAGGAGGCGAAGAAGGAAGG - Exonic
992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG + Intronic
994379916 5:99058625-99058647 GTGAAGGAGCTGAACAAGGAAGG + Intergenic
994450568 5:99936406-99936428 ATGGAGAAGGTAAACCAGGATGG + Intergenic
994977579 5:106829672-106829694 CTGGAGAAGCTGACCAATGACGG + Intergenic
995090236 5:108166362-108166384 TTGCAGGAGTAGAACAAGGAGGG - Intronic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996904180 5:128578540-128578562 ATAGGGGAGTTGAACAAGCATGG + Intronic
996908014 5:128623980-128624002 ATGAAAGAGTTGGACAAGGAGGG + Intronic
998517734 5:142770867-142770889 ATCAAGGAGCTCATCAAGGACGG + Exonic
999956537 5:156709365-156709387 GGAGAGGAGGTGAACAAGGAAGG - Intronic
1000527400 5:162374898-162374920 ATGTAGGAGCAGAACATGTAGGG - Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000718027 5:164671044-164671066 ATGGAGAAACTGATCAAAGAGGG - Intergenic
1001651443 5:173318878-173318900 ATGGAAGAGCTGAAGTGGGAGGG + Intronic
1003167615 6:3694964-3694986 AAGGAGGAGGAGGACAAGGAGGG - Intergenic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1004179103 6:13365503-13365525 ATGAAGCAGCTGATCGAGGAGGG - Exonic
1005385554 6:25280664-25280686 ATGGCAGAGCTGAAATAGGATGG + Intronic
1005510280 6:26506346-26506368 ATGAAGGAGGTAAATAAGGAAGG - Intronic
1005878080 6:30030469-30030491 TTGGTGGAACTGAACAATGAAGG + Intergenic
1006022004 6:31122856-31122878 CTGGAGGACCTGGGCAAGGAGGG + Intronic
1007476998 6:42125538-42125560 AGGCAGGAACTGAACCAGGAAGG - Intronic
1007667491 6:43523899-43523921 ACGGAGGTGCTGGACAATGATGG - Exonic
1007751282 6:44073459-44073481 ATGGAGGAGACGCACAAGGGAGG - Intergenic
1008058436 6:46970878-46970900 GTGGAGGGGTTGAACAAAGAAGG - Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1012218662 6:96620863-96620885 ATGGAGGAAATCAAAAAGGAGGG + Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1013005215 6:106066227-106066249 ATGGAGGGGCTTAACCAGCAGGG - Intergenic
1015100438 6:129472274-129472296 ATGTAGGATCTGAATAAGCAAGG - Intronic
1015414327 6:132931718-132931740 ATGGGGGAGCTGGAGAAGGGAGG - Intergenic
1015786553 6:136924445-136924467 ATGGAGGAGCTGCCCGGGGAGGG + Exonic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016368734 6:143347703-143347725 AAGGAGGAGCTGTAAAAAGAAGG + Intergenic
1016549309 6:145259015-145259037 ATGGAGGAAGTCAAAAAGGAAGG - Intergenic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017318061 6:153055482-153055504 ATGGTGGAGAAGAACAAGGCAGG + Intronic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1022827357 7:34029424-34029446 ATGGAGGAGAGGCAAAAGGAAGG + Intronic
1023009198 7:35910239-35910261 ATGAAGGAGCTGTACAAGAGCGG + Intergenic
1023295999 7:38715630-38715652 ATGGAGGCACTTAACAGGGAAGG + Intergenic
1023635226 7:42202982-42203004 AAGGAGGAGCTGACCATGGGAGG + Intronic
1023823011 7:43990474-43990496 AGGGAGGGGCTGAGGAAGGAGGG + Intergenic
1024107482 7:46107946-46107968 ATGGAGGAGTTGTAGAATGAAGG - Intergenic
1024354652 7:48402192-48402214 ATGGAAGAAATGAAGAAGGAGGG + Intronic
1024511416 7:50207578-50207600 ATCAAGGAGCTTAAAAAGGAGGG + Intergenic
1026844488 7:73690430-73690452 TTGGAGGAAGGGAACAAGGAGGG + Intronic
1027488527 7:78792130-78792152 ATGGGGGAGTTGAACAAGTTTGG + Intronic
1028537180 7:91902673-91902695 ATAAAGGAACTAAACAAGGATGG - Intergenic
1028621140 7:92830924-92830946 ATGGAGCAGCTTCACAGGGAGGG - Intronic
1028661307 7:93279399-93279421 ATAGAGGAGCTGAATAAAGAAGG + Intronic
1029625782 7:101719310-101719332 TGGGAGGAGCTGGACGAGGAGGG + Intergenic
1031697714 7:124879178-124879200 ATCCAGGAGGTGAACAAAGATGG + Intronic
1032030305 7:128477310-128477332 AGGGAGGGGATGAGCAAGGAGGG + Intronic
1032416779 7:131741608-131741630 TGGGAGGAGCTGAGGAAGGATGG - Intergenic
1032705500 7:134418108-134418130 ATGCAGGAGCTGCAAAAGGCTGG + Intergenic
1032785984 7:135199760-135199782 GTGGAGGGGCTGAATAAGGCAGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034224189 7:149470136-149470158 GTGGATGAGGAGAACAAGGAAGG + Intergenic
1034538829 7:151743162-151743184 AGGGAGGGGCTGAAAAAGGAAGG + Intronic
1036554929 8:9850836-9850858 ATGGAGGGTCTGACCCAGGAAGG + Intergenic
1038046185 8:23767419-23767441 TTGGAGGAGTTGACCAGGGAAGG + Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038382185 8:27106288-27106310 AGGGCGGAGATGAACAAGAAGGG - Intergenic
1040576303 8:48654382-48654404 ATGGAAGAGAGGAAGAAGGAAGG - Intergenic
1040757010 8:50788874-50788896 ATGGAGAGGCTGGACATGGATGG - Intronic
1041083473 8:54235298-54235320 AAGGAGAAATTGAACAAGGAGGG + Intergenic
1042559976 8:70066144-70066166 AGGGAGGAGCTGTGCATGGAGGG + Intronic
1044326536 8:90865090-90865112 AGGGCGGAGCAGAACAAGCATGG + Intronic
1044331054 8:90920762-90920784 ATGGGGGAGATAAACAAGGAAGG - Intronic
1044552343 8:93526211-93526233 ATGGAAGAGTAGAAAAAGGAGGG - Intergenic
1045523506 8:102923533-102923555 ATGGAGGAGATGTATAAGAAAGG - Intronic
1045729695 8:105222715-105222737 AGGGAGGAGGGGAACAACGACGG + Intronic
1050167131 9:2777042-2777064 AAGTGGGAGCTGAACAATGAGGG + Intronic
1050310341 9:4346606-4346628 CTAGAGAAGCTGACCAAGGATGG - Intronic
1050676069 9:8054044-8054066 AGGGATGAGTTGAACAAGCAAGG - Intergenic
1051756337 9:20404931-20404953 ATGGAGGATCTGAGGAAGGAAGG - Intronic
1055195991 9:73594764-73594786 ATGGTGGAGTTTAAAAAGGAAGG + Intergenic
1056006365 9:82275796-82275818 AAGGAGGAGGAAAACAAGGAAGG - Intergenic
1056813164 9:89780196-89780218 ATGGCTGAGCTGTAGAAGGAAGG - Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1058774954 9:108273879-108273901 AGGGAGGGGCTGAACCAGGATGG - Intergenic
1058902373 9:109453154-109453176 AGGGAGGAGGTGCACAAAGAAGG + Intronic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1060241548 9:121908047-121908069 AAGGAGTAGGTGAACAAAGAAGG + Intronic
1061594509 9:131620207-131620229 ATGGAGAAGATGCCCAAGGATGG + Intronic
1061769277 9:132905575-132905597 AGCAAGGAGCTGAACAAGTAAGG - Exonic
1062213275 9:135376032-135376054 ATGGGGAAGCTGAACTTGGACGG + Intergenic
1062361052 9:136188305-136188327 AAGGAGGGGCTGAACTGGGAGGG + Intergenic
1187213256 X:17250309-17250331 AGGGAGCAGCTGAACCAGGCTGG - Intergenic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1188062998 X:25623975-25623997 ATGATGGAGATGAATAAGGAGGG - Intergenic
1188296146 X:28451601-28451623 ATGGAGGAGCCAAACAGGAAAGG - Intergenic
1188676902 X:32952426-32952448 CTAAAGGAGCTGAACAAGGCTGG - Intronic
1189848406 X:45157023-45157045 AGAGAGGAGCTGGAAAAGGAGGG - Intronic
1190405353 X:50081352-50081374 AAGGAGGAGCTGGAGAGGGAGGG - Intronic
1192055058 X:67765637-67765659 AATGAGGAGCTGAGCAAGGAGGG - Intergenic
1193745559 X:85275411-85275433 AGGGTGGAGCTGAACAAAGTTGG - Intergenic
1194633709 X:96318478-96318500 ATGGACGTGGTGAAAAAGGAAGG - Intergenic
1194800849 X:98270347-98270369 ATGGAAGATCTCTACAAGGAAGG + Intergenic
1196001615 X:110793414-110793436 AGGGAGGAGGTAAAGAAGGAAGG - Intronic
1196596701 X:117554112-117554134 AAGTAGGAACTGGACAAGGAGGG + Intergenic
1197537001 X:127702564-127702586 AAGGAAGATCTGAAAAAGGAAGG - Intergenic
1197591753 X:128418451-128418473 ATGGGAGAGTTGAACAGGGATGG - Intergenic
1197682419 X:129400616-129400638 GTGGAAGAGGTGAAAAAGGAAGG + Intergenic
1197828286 X:130614137-130614159 AGTGAGGAAGTGAACAAGGATGG - Intergenic
1198229169 X:134673274-134673296 ATGGAGGAAGGGAAGAAGGAAGG + Intronic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1198897439 X:141471334-141471356 AGGGAGTAGCTGCACCAGGAAGG - Intergenic
1199453229 X:147996999-147997021 ATGGAGGAGGGGAAAAAGGCTGG + Intronic
1201907433 Y:19100177-19100199 AAGGAGGAGCTAAAGAAGAAAGG - Intergenic