ID: 953043942

View in Genome Browser
Species Human (GRCh38)
Location 3:39278885-39278907
Sequence CAGGCTCAGGTTTGTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953043942_953043946 -7 Left 953043942 3:39278885-39278907 CCACCCACACAAACCTGAGCCTG 0: 1
1: 0
2: 1
3: 35
4: 261
Right 953043946 3:39278901-39278923 GAGCCTGAGTATCCTCACAATGG 0: 1
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953043942 Original CRISPR CAGGCTCAGGTTTGTGTGGG TGG (reversed) Intronic
900926433 1:5709183-5709205 CAGGCTCAGGTTGGGGCAGGTGG + Intergenic
901222730 1:7592790-7592812 GAGGCTGAGGTGTGTGAGGGTGG - Intronic
901532319 1:9861344-9861366 CAGGTCTTGGTTTGTGTGGGAGG - Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
903668346 1:25021460-25021482 CAGGCAGAGGTTGGTGTGGGAGG + Intergenic
903708695 1:25305981-25306003 CTGGCTCACGGCTGTGTGGGAGG + Intronic
903718415 1:25386437-25386459 CTGGCTCATGGCTGTGTGGGAGG - Intronic
904417766 1:30373594-30373616 CAGGCCCTGGTCTGTGTGTGAGG + Intergenic
904907988 1:33912415-33912437 CAGCCTCAGGAGTGTGTGTGGGG - Intronic
906290462 1:44616599-44616621 CAATCCCAGGTGTGTGTGGGCGG - Intronic
906890651 1:49709368-49709390 CATGCTGAGGCTTGTGTAGGTGG - Intronic
907393093 1:54171391-54171413 CAGGCTTGGATTTGTGTGTGGGG + Intronic
907551772 1:55310808-55310830 CAGGCCGGGGTCTGTGTGGGAGG + Intergenic
907700842 1:56786517-56786539 CAGGAACATCTTTGTGTGGGAGG + Intronic
909227674 1:73045614-73045636 CAGGTTCAGGTTTGCATGAGAGG + Intergenic
912659451 1:111515321-111515343 CAGGCTCAGTTTTTAGTAGGTGG - Intronic
915107023 1:153541093-153541115 GAGGCTGAGGTTTTTGTGGTGGG - Intronic
916215480 1:162389858-162389880 CAGGCTCAGGATAAAGTGGGGGG - Intergenic
919145709 1:193632139-193632161 CAGAGTCAGGTATCTGTGGGAGG + Intergenic
920093017 1:203467596-203467618 CATGATCAGGTTTGTGTTTGAGG + Intergenic
920870403 1:209789517-209789539 CAGACTCAGGTTTGTGCAGTAGG - Intronic
921783559 1:219198866-219198888 AAAGCTCAAGTTTGTGTTGGTGG - Intronic
921825256 1:219665382-219665404 CAGGGTCAGCATTGTGTGTGAGG - Intergenic
923966552 1:239147151-239147173 CAGTCTCAGGTTGGTGGGAGGGG + Intergenic
924846149 1:247774255-247774277 CAGGCTCATGTTTCTTTTGGAGG - Intergenic
1063664146 10:8051681-8051703 CAGGATCAGCTTTGTGGCGGTGG + Intergenic
1064537843 10:16376998-16377020 CAGGCTGAGGTCGGGGTGGGAGG - Intergenic
1066281571 10:33923212-33923234 CAGGGTCAGATGTGTCTGGGTGG + Intergenic
1066657035 10:37705623-37705645 CAGGCCCAGGGTGGTGTGGCAGG + Intergenic
1067041580 10:42955863-42955885 CAGGCCCAGGGTGGTGTGGCAGG + Intergenic
1067210591 10:44257767-44257789 CAGGGTCAGGTGTGTTTGGGAGG - Intergenic
1067848819 10:49742571-49742593 CAGGATCATGTGTGTGTGGGGGG - Intronic
1073511505 10:104045531-104045553 AAGGCTCAGGTTTGTGGGGTGGG + Intronic
1075656728 10:124166742-124166764 GAGGCACAGGTGTGGGTGGGAGG - Intergenic
1076071583 10:127494319-127494341 CATGCTCAAGTTTGGGGGGGTGG - Intergenic
1076263333 10:129089610-129089632 CTGGCTCAGATTTGAGTTGGGGG + Intergenic
1076602385 10:131667207-131667229 CAGGCTGAGGCTTGTGGGGAGGG + Intergenic
1076690582 10:132222104-132222126 CAGCATCAGGTGTGTGTGTGGGG - Intronic
1077106836 11:845861-845883 AGGGCTCAGGTTTGGGTGGGAGG + Intronic
1077754930 11:5017014-5017036 CAGATTCAGGTTTGAGAGGGAGG - Intergenic
1078090015 11:8259303-8259325 AAGGCTCGGGTGTGTGTGTGGGG + Intronic
1079668929 11:23141890-23141912 CAGGCTCAGGGTGGTGGTGGGGG - Intergenic
1080394464 11:31877063-31877085 AAGGCTATGGTTTGTGTAGGGGG + Intronic
1081747498 11:45483309-45483331 CAGGCACAGCTTTGTGTTTGGGG + Intergenic
1084180344 11:67442895-67442917 CTGGCTCTGGTGTGTGTCGGGGG + Intronic
1084456276 11:69269889-69269911 CAGGCTCGTGTGGGTGTGGGAGG - Intergenic
1084604684 11:70165611-70165633 CAGGCGGAGGGGTGTGTGGGTGG + Intronic
1085258172 11:75188923-75188945 CAGGCTCAGCAGTGGGTGGGAGG - Intronic
1086554657 11:88094684-88094706 CAGGCTCAGGTTAAAGTAGGTGG - Intergenic
1087439191 11:98161361-98161383 CAGGCTCAGGCTTGTGAGCAGGG - Intergenic
1089681498 11:120121445-120121467 CAGGCTCAGGGTGGAGTTGGGGG - Intronic
1089985179 11:122805713-122805735 CAGGATGAGATTTGGGTGGGGGG + Intronic
1090248152 11:125231702-125231724 CACACACAGGTGTGTGTGGGGGG + Intronic
1090835995 11:130454293-130454315 CAAGCTCAGGGTTGTGAGAGGGG - Intronic
1092171590 12:6376723-6376745 CAGGGCCTGGGTTGTGTGGGTGG - Intronic
1100044948 12:90368338-90368360 CAGCCTCAGATTTGTGTCTGAGG - Intergenic
1100893173 12:99148925-99148947 TAGGCTCAGAGTTGAGTGGGTGG - Intronic
1103942749 12:124509874-124509896 GAGGCTCAGGTTACTGTGGGGGG - Intronic
1104318558 12:127727430-127727452 CAGGCTTAGGTTCATGTTGGAGG - Intergenic
1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG + Intronic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1106579799 13:31007632-31007654 CAGGATCCAGTCTGTGTGGGAGG + Intergenic
1107989054 13:45801244-45801266 CAGGAAAAGGTTTGTGTTGGGGG + Intronic
1108903654 13:55444242-55444264 AAGTCTCAGGTTTGTGAGGATGG + Intergenic
1110279138 13:73672350-73672372 AAAGCAGAGGTTTGTGTGGGTGG - Intergenic
1111949985 13:94702623-94702645 CAGGCTAGGGTGTGTGTGTGCGG + Intergenic
1111971148 13:94918089-94918111 TAGTCTCAGGTATGTGTGAGAGG - Intergenic
1113812281 13:113150017-113150039 CCAGCTCAGGCTTGTGTGGTGGG + Intergenic
1114697979 14:24645071-24645093 CAGGCTCAGGCTTGTATGAGAGG + Intergenic
1114866450 14:26599657-26599679 CAGTCTCTGTTTTGAGTGGGAGG - Intergenic
1119573523 14:75697540-75697562 CAAAGTCAAGTTTGTGTGGGAGG + Intronic
1121504883 14:94469516-94469538 CAGACTCTGGTGTGTGTGTGAGG + Exonic
1122259149 14:100502213-100502235 CAGGCTCAGAGCTGAGTGGGAGG - Intronic
1123631103 15:22259863-22259885 CAGGCTGACGTTTGAGTAGGAGG + Intergenic
1125322504 15:38503208-38503230 CTGGCTCAGTTTTGTATGTGGGG - Intronic
1125671963 15:41480317-41480339 CCAGCTCAGGTATGTGAGGGTGG + Exonic
1129356334 15:74994541-74994563 CAGGCCTAGGATGGTGTGGGTGG + Intronic
1131102438 15:89703500-89703522 CAAGCTCTGGTTTGTATGAGAGG - Intronic
1133961554 16:10497916-10497938 CAGGCTCAGGTGTGTGGGTCAGG - Intergenic
1135245295 16:20851304-20851326 AATACTCAGGTGTGTGTGGGAGG - Intronic
1137533623 16:49300297-49300319 CAGACACAGGGTTGTGTGTGTGG + Intergenic
1138183518 16:54959447-54959469 CAAGCTCAGGGGTTTGTGGGTGG - Intergenic
1138573439 16:57890960-57890982 AAGGCTGAGGTGTGGGTGGGAGG - Intronic
1140760215 16:78102865-78102887 CAGCCGCAGGCTTCTGTGGGTGG + Intronic
1141628634 16:85275114-85275136 CAGGCCCAGGTCTGTGTCTGCGG - Intergenic
1142126132 16:88411566-88411588 CAGCCTCAGGTGTGTTTGGAAGG + Intergenic
1142470150 17:158672-158694 CAGGCAGAGCTTTGTGTGTGAGG + Intronic
1142886590 17:2916508-2916530 TGGGCTCAGGTTTGTCTGTGTGG + Intronic
1142981782 17:3676689-3676711 CAGGTTCTGATTTGGGTGGGGGG + Intronic
1143749108 17:9015529-9015551 CAGGCTAATGTTTGTGAGGAGGG - Intergenic
1143780277 17:9225611-9225633 CTGGCCCAAGTCTGTGTGGGAGG - Intronic
1143973828 17:10815434-10815456 CAGGCCAAGGTAGGTGTGGGTGG - Intergenic
1144775114 17:17781443-17781465 CAGGCTGGGGTTTGCATGGGTGG + Intronic
1146267306 17:31461235-31461257 CAGGCCCAGGCTTGTGCGTGTGG - Intronic
1146565057 17:33905767-33905789 CAGGGACAGGTCTGTGAGGGTGG + Intronic
1147794705 17:43034155-43034177 CAGGCTGAGGAAGGTGTGGGGGG + Intergenic
1147947596 17:44088740-44088762 GGAGCTCAGGTTTGGGTGGGGGG - Intronic
1147998489 17:44374645-44374667 GAAGCTCAGGTGAGTGTGGGGGG - Exonic
1150219019 17:63485386-63485408 CATGCTCAGGTTTGGGGGTGGGG - Intronic
1150739175 17:67765812-67765834 CAGGCACAGGTCTCTGGGGGAGG - Intergenic
1151362133 17:73595468-73595490 CAGACTCATGGCTGTGTGGGAGG - Intronic
1151803541 17:76391603-76391625 CAGGATCAGACCTGTGTGGGCGG + Exonic
1151898609 17:76996995-76997017 CAGGCCCAGGTTTGTGTGTCAGG - Intergenic
1152564983 17:81096358-81096380 CAGCCTCAGGAATGTGTGTGAGG - Intronic
1152882042 17:82823182-82823204 CTGGCTCAGGCTCTTGTGGGGGG + Intronic
1153227009 18:2906987-2907009 CAGGCGCAGGCGTGTCTGGGCGG + Exonic
1154329711 18:13419864-13419886 CAGGCTCACGTCTGTGTCTGTGG - Intronic
1155071953 18:22324775-22324797 CAGGCAGTGGTTTGAGTGGGTGG + Intergenic
1156354943 18:36332725-36332747 CTGGCTCAGGTTGGAGTGGGTGG + Intronic
1157545025 18:48540717-48540739 ACGGCTCCGGTGTGTGTGGGGGG + Intronic
1159241610 18:65750372-65750394 CAGGCTAAGGTGGGTGTTGGAGG + Intronic
1160383407 18:78478073-78478095 AAGGCTCAGGTCTGTGAGTGTGG + Intergenic
1160451392 18:78968731-78968753 CAGGCTCAGGAGGGTGTGGGAGG - Intergenic
1160591275 18:79945882-79945904 CAGCCTCAGGTCTCTGTGGGTGG - Intronic
1160753874 19:747821-747843 CAGGCTCACATTGGTCTGGGTGG - Exonic
1160972904 19:1777547-1777569 AAGGCCCAGGTTTTAGTGGGAGG - Exonic
1161322772 19:3648948-3648970 CAGGCACACGTGTGTGTAGGGGG - Intronic
1161326028 19:3664711-3664733 CAGACCCTGGTTTGTGTCGGGGG + Intronic
1162531605 19:11239424-11239446 CAGGGCCAGGTGTGGGTGGGGGG - Intronic
1162667097 19:12223016-12223038 CAGGCTGGGTTTTGGGTGGGTGG + Intergenic
1163749050 19:19064508-19064530 CAGGCTCAGGTGTGGGTGTGGGG - Intronic
1165376743 19:35448422-35448444 CAGGATCAGGTTTGAGGGGAAGG + Intronic
1165453061 19:35896355-35896377 CAGGCAGGGGTTTGTCTGGGGGG - Intronic
1165509043 19:36255557-36255579 CAGGCTCAGGCCTGCGTGGACGG + Intergenic
1165509525 19:36257922-36257944 CAGCCTCAGGTGTGTGCGGACGG + Intergenic
1166361806 19:42255629-42255651 CAGGCTCAGGGTTGGGGGGTTGG - Intergenic
1166407493 19:42531508-42531530 CTGGCTCAGGTGTGTGGAGGAGG + Intronic
1166906712 19:46115564-46115586 CAGGCTGAGGTTTCTGGGGTTGG - Intergenic
1166938653 19:46350078-46350100 CAGGGTCAGGTTTGTGTTTTAGG + Intronic
1167025535 19:46914365-46914387 GAGGCTGAGGTGTGAGTGGGAGG + Intergenic
1167145881 19:47680708-47680730 CAGGTTCTGGTTTGTGAGGATGG - Exonic
1167398041 19:49244425-49244447 CAGGCTGAGGTTTGAGTCTGAGG - Intergenic
1167792612 19:51690890-51690912 CCGGGCCAGGTTGGTGTGGGGGG + Intergenic
1168342953 19:55636190-55636212 CAGGGTCAGGCCAGTGTGGGAGG + Intronic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
926055020 2:9769412-9769434 CATACACAGGTGTGTGTGGGGGG - Intergenic
926124661 2:10264756-10264778 CAAGCTCAGGAATGTGCGGGTGG - Intergenic
928086747 2:28350812-28350834 TAGGCCCAGGGCTGTGTGGGAGG - Intergenic
928220464 2:29398944-29398966 CAGGGTGAGGCTTGTGTGGCAGG + Intronic
929096140 2:38264891-38264913 CAGGCTCTGCTTTGTGAGGAGGG + Intergenic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
931297912 2:60947947-60947969 CAGGGTCAGCTTGGTCTGGGAGG - Intronic
931966581 2:67542748-67542770 CAGGGTCAGGCTTGTGTGAGAGG - Intergenic
932811985 2:74833824-74833846 CAGGCTCGGCTATGGGTGGGGGG - Intergenic
933276381 2:80288748-80288770 CAGGCCCAGCTCTTTGTGGGGGG - Intronic
934504145 2:94878625-94878647 AGGGGTCAGGTGTGTGTGGGTGG + Intergenic
934927758 2:98393541-98393563 CAGGCTGAGGCTTGCGTGGGTGG + Intronic
935653763 2:105404238-105404260 CTGGCCAAGGTTTGAGTGGGAGG - Intronic
936574603 2:113642547-113642569 CAGACTCAGCTGTGGGTGGGGGG - Exonic
937145944 2:119644537-119644559 CGGGCCCAGGTTTGTTTTGGTGG + Intronic
937311740 2:120907010-120907032 CAGGGACAGGTTGGTGTGGAGGG - Intronic
937910749 2:127074399-127074421 CGGGCTCAGGTTTGGTGGGGTGG - Intronic
938138896 2:128780841-128780863 CAGTCTCAGGTATGTGAGGAAGG + Intergenic
938639978 2:133267302-133267324 CAGCCTCAGCTCTGTCTGGGTGG + Intronic
939841913 2:147199413-147199435 CTTGCTAAGGCTTGTGTGGGTGG + Intergenic
940131363 2:150386971-150386993 CAGGTTCAGGTTTGCATGAGAGG - Intergenic
944210231 2:197199114-197199136 GAGGCTCTGGTTTCTGTGGTGGG - Intronic
946667488 2:222066358-222066380 CAGGATCAGCTTTGTGTTTGGGG - Intergenic
947190462 2:227499750-227499772 CAGGCAGAGGTTTGTGTTAGGGG + Intronic
947769986 2:232662870-232662892 CAGGCCCAGGTGGGTCTGGGGGG - Exonic
947859382 2:233348062-233348084 CTGGCTCAGCTTTGGCTGGGAGG + Intergenic
1169268651 20:4182625-4182647 CAGCCTACAGTTTGTGTGGGAGG + Exonic
1169452020 20:5719981-5720003 CAGTCTGAGGCTGGTGTGGGAGG + Intergenic
1170137769 20:13094061-13094083 CAGGGTCTGGTTTGTGTGGCTGG + Intronic
1171185575 20:23121875-23121897 CAGGCACAGGATGGTGGGGGTGG + Intergenic
1172446225 20:34994837-34994859 CAGGCTCAGGCTAGTGCAGGAGG + Intronic
1173806218 20:45927080-45927102 CAGGCTCTGGTTTCTGTGGTGGG - Intergenic
1173846785 20:46193413-46193435 CAGGCTCAGCTTTGGGCTGGAGG - Intronic
1174726304 20:52865953-52865975 AAGGCACAGGTTTGTATGTGTGG - Intergenic
1176071346 20:63228146-63228168 GAGGCTGAGGTTTCAGTGGGCGG - Intergenic
1176218197 20:63958002-63958024 CAGGCCGAGGTGTGCGTGGGTGG + Exonic
1177120179 21:17128344-17128366 CAGACACAGGTTTGTCTTGGTGG + Intergenic
1177180673 21:17741608-17741630 CAGGCTAAGGTGTGAGTAGGCGG + Intergenic
1179633429 21:42692562-42692584 CAGTCTCTGGTTTGTGACGGAGG + Intronic
1179826481 21:43968902-43968924 GAGGCTCAGGCTTGGCTGGGAGG - Intronic
1182476107 22:30577152-30577174 CAGGCTGAGGTATGTGTAGAAGG + Intronic
1182666593 22:31964657-31964679 CAGGGTCATGTGTGTGTGGTGGG + Intergenic
1182712196 22:32330076-32330098 GAGGCTCTGGTGTGTGTGTGGGG + Intergenic
1182852841 22:33490991-33491013 CAGGCTCAGGTTTGTCTGGCTGG - Intronic
1183605220 22:38863941-38863963 CAAGCTGAGGTTTGGGAGGGTGG - Exonic
1183947628 22:41335708-41335730 CAGGCTCAGGTGTGGGAAGGAGG + Intronic
1184313550 22:43664805-43664827 CAGGCCCTGGTTTGTGTTTGAGG + Intronic
1184597727 22:45524396-45524418 CAGCCTCATGGTTGTGTTGGAGG + Intronic
1185425569 22:50768329-50768351 CAGACTCAGCTGTGGGTGGGGGG + Exonic
949773861 3:7609558-7609580 CAGGCACAGGTATGGGTAGGTGG + Intronic
950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG + Intronic
950381925 3:12623507-12623529 CAGGCTAAGGGTTGGGTGCGGGG + Intronic
952325265 3:32314839-32314861 TAGGCTCAGGGTTGGGTGGCGGG + Intronic
952653763 3:35758873-35758895 CATGCTTATGTGTGTGTGGGTGG + Intronic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
956667248 3:71653772-71653794 CAAGTCCAGGTTTGTTTGGGGGG + Intergenic
957177227 3:76826975-76826997 CAGGCTGATGTTTGTGTGTTGGG + Intronic
959197210 3:103199816-103199838 CAGGCTCAGGTACATGTGCGTGG - Intergenic
959351361 3:105268922-105268944 CAGGATGAGATTTGGGTGGGTGG - Intergenic
962368600 3:134802618-134802640 CAGGCCCAGGCTTGTGCAGGTGG + Intronic
963344373 3:144076453-144076475 TAGGCTTGGGTTTATGTGGGAGG + Intergenic
963972989 3:151450002-151450024 CAGGTTCAGGTTTAAGGGGGAGG + Intronic
968923776 4:3536341-3536363 CAGGCACTGGGTTGTGGGGGAGG + Intergenic
972629937 4:40834081-40834103 CAGCCTCAGGCTTTTTTGGGAGG + Intronic
973246490 4:48016292-48016314 CAGGCTCAAGTTTATTTTGGGGG - Intronic
975631710 4:76410588-76410610 CAGTCTCAGGTTTCTGTGGAAGG - Intronic
975909291 4:79248607-79248629 CAGGCACAGGTTTGTGCCGGTGG - Intronic
976206501 4:82627543-82627565 CAGTCTCTGGCTTGTGTGTGGGG + Intergenic
985647870 5:1093584-1093606 CTGGCTCAGGTTGGTGTAGTTGG + Exonic
985869324 5:2541395-2541417 CAGGCTCTGCTGTGTGTGTGTGG + Intergenic
986348029 5:6852640-6852662 CAGGCCCAGGTGAGTGTAGGTGG + Intergenic
993195293 5:84734285-84734307 CAGGAGCAGGTTTTTGTGGTGGG + Intergenic
993556534 5:89346687-89346709 ACTGCTCAGCTTTGTGTGGGAGG - Intergenic
994417689 5:99495608-99495630 CAGTGTAAGGTTTGTGTGTGTGG - Intergenic
994462274 5:100079551-100079573 CAGTGTAAGGTTTGTGTGTGTGG + Intergenic
997614978 5:135240109-135240131 CTGGCTGAGGGCTGTGTGGGCGG - Intronic
999131773 5:149289068-149289090 CATGCACAGGTTTGTGTGAGGGG - Intronic
1001834478 5:174820102-174820124 CTGCCTCAGGTGGGTGTGGGTGG + Intergenic
1002090492 5:176802766-176802788 GAGGCCCAGGTTTGTGTGTGGGG - Intergenic
1002921296 6:1575246-1575268 CAGGCTCCTGTGTGGGTGGGTGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006445488 6:34077463-34077485 TAGGCTGAGGTTTGTGTGGCAGG - Intronic
1006457781 6:34141883-34141905 CAGCCTCAGGTTCATCTGGGAGG + Intronic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1011934783 6:92762559-92762581 TAGGCTCTGGTTTGTGCTGGAGG + Intergenic
1012007761 6:93735831-93735853 GAGGATCAGGTTTGTGTGCCAGG + Intergenic
1012829663 6:104188257-104188279 CAGGTTCAGGCTTGTATGAGAGG + Intergenic
1013375951 6:109514278-109514300 TAGGCTTAGGTTTGGGTTGGCGG + Exonic
1016750186 6:147623235-147623257 CAGGCTCTGGGGTGTCTGGGAGG - Intronic
1017721276 6:157244946-157244968 CAGGCTCAGGTGGGTTTAGGGGG + Intergenic
1022117211 7:27272416-27272438 CAGGCACAGGGTTGTGTGAGGGG + Intergenic
1024938047 7:54732290-54732312 AAGGCTGATGTTTGTGTTGGTGG + Intergenic
1029381671 7:100219447-100219469 CAGGCTGGGGGTTGTGGGGGAGG + Intronic
1029401832 7:100351895-100351917 CAGGCTGGGGGTTGTGGGGGAGG + Intronic
1029744247 7:102507889-102507911 CAGGAGCAGGTGTGTGTGGGGGG + Intronic
1029762238 7:102607051-102607073 CAGGAGCAGGTGTGTGTGGGGGG + Intronic
1031035285 7:116781727-116781749 CAGGCTAATTTTTTTGTGGGCGG + Intronic
1031971963 7:128071682-128071704 CAGGCTGAGGTTTGTGGAGAAGG + Intronic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1032398965 7:131610465-131610487 CAAGCTCAGGTTTGGGGGTGGGG + Intergenic
1033447608 7:141436484-141436506 CAGGCTCAGATGTGGATGGGTGG + Intronic
1034224677 7:149473543-149473565 CAGCCCCAGGTTGGGGTGGGCGG + Exonic
1034537234 7:151733056-151733078 CAGGCACAGGCTTGGGAGGGAGG + Intronic
1034701390 7:153099300-153099322 GTGGCTGAGGTCTGTGTGGGGGG - Intergenic
1035069148 7:156128117-156128139 CAGGGTCAGGTGGGTGGGGGAGG + Intergenic
1035571032 8:672524-672546 CAGGTTCAGGTTAATGTGGTGGG - Intronic
1038356011 8:26830141-26830163 CAGGGTCAGCTCTGGGTGGGAGG - Intronic
1039839881 8:41285836-41285858 CAGGCTCAGGCTAGGGTCGGGGG + Intronic
1040062460 8:43115599-43115621 CAGGGTCAGGGTGGTTTGGGGGG - Intronic
1040289958 8:46119209-46119231 CAGTCGCAGGGTGGTGTGGGCGG - Intergenic
1040317928 8:46274765-46274787 GGGGCGCAGGTTTGTGTGGTGGG + Intergenic
1041432915 8:57804514-57804536 CAGGCTGGCGTTTGGGTGGGAGG + Intergenic
1041723460 8:60997159-60997181 AAGGCTCAGGTGTGTGTGGCGGG + Intergenic
1044491038 8:92815290-92815312 CAGGGTCGGCGTTGTGTGGGGGG + Intergenic
1046629327 8:116607822-116607844 CAGGGTCATATTTGTGTGGCAGG + Intergenic
1047195276 8:122715490-122715512 CAGTCTCAGGGTTGTCAGGGAGG - Intergenic
1047474384 8:125212529-125212551 CAGGCTGAGGTTTGAGTGGAGGG + Intronic
1047510752 8:125513517-125513539 CAGGCTCAGGTGGGTGAGAGAGG - Intergenic
1048129958 8:131684814-131684836 CAGGCTCATGTTTGGTTGAGGGG - Intergenic
1048224610 8:132572981-132573003 AAGGCTCAGGTTCTTGTGGGAGG - Intronic
1048375474 8:133818928-133818950 CAGGGTCAGCTTGGGGTGGGGGG + Intergenic
1049360321 8:142209685-142209707 GAGGCTCAGGCTGCTGTGGGAGG - Intergenic
1049392827 8:142380941-142380963 CAGGTGCATGTGTGTGTGGGGGG - Intronic
1049502487 8:142974829-142974851 CAAGCTCTGGTCTGTGCGGGGGG - Intergenic
1049552366 8:143266582-143266604 GACGCTCAGGGCTGTGTGGGTGG - Intronic
1049605145 8:143525906-143525928 CAGGCTTGGGGTTGTGTGGCAGG - Intronic
1049849781 8:144824675-144824697 CAGGCTCAGGGCTGTAGGGGTGG - Intergenic
1051394189 9:16601598-16601620 CAGGCTCAGGAGTGTGTAGTAGG - Intronic
1053799488 9:41755364-41755386 CAGGCACTGGGTTGTGGGGGAGG + Intergenic
1053886220 9:42646491-42646513 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1054145727 9:61559633-61559655 CAGGCACTGGGTTGTGGGGGAGG - Intergenic
1054187897 9:61967425-61967447 CAGGCACTGGGTTGTGGGGGAGG + Intergenic
1054225240 9:62453940-62453962 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1054465469 9:65490737-65490759 CAGGCACTGGGTTGTGGGGGAGG - Intergenic
1054650617 9:67621156-67621178 CAGGCACTGGGTTGTGGGGGAGG - Intergenic
1056121236 9:83491431-83491453 AAGGCTCAGGTATGTGCTGGAGG - Intronic
1058865734 9:109160680-109160702 CAGGCTCTGGTTTCTGAGGTAGG - Intronic
1060521137 9:124294793-124294815 CAGGTTCAGGCTTGTGTGTTAGG + Intronic
1060984009 9:127809605-127809627 CGGGCTCAGGAGTGTGTGTGCGG + Intronic
1061052701 9:128205577-128205599 CAGGCACAGGGACGTGTGGGTGG + Intronic
1061200910 9:129137999-129138021 CGGGCGGAGGTTTGTGGGGGAGG + Intronic
1061307135 9:129738624-129738646 CTGGCTCAGGTGTGGGTGGGAGG - Exonic
1061972854 9:134054165-134054187 CGGGCCCAGGTTTGTGATGGCGG + Intronic
1062486157 9:136777195-136777217 AAGACTCATGTTAGTGTGGGTGG + Intergenic
1203791141 EBV:152219-152241 CAGGCACACATTTCTGTGGGAGG + Intergenic
1203791460 EBV:153931-153953 CAGGCTCCGGGTGGTGTGGGCGG + Intergenic
1186566431 X:10667619-10667641 CAGGAACAGGGGTGTGTGGGGGG + Intronic
1188267232 X:28092664-28092686 CAGGCTCTGGTTTTTGTTTGGGG + Intergenic
1188482764 X:30652435-30652457 CAGGCTCCAGTGTGTGTGGGCGG - Intergenic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1190444916 X:50514847-50514869 CAGGCTCAGGGTTGTCTGCCTGG - Intergenic
1191002868 X:55679779-55679801 CAGGTTCAGTTTTTTGAGGGTGG + Intergenic
1192195947 X:69028254-69028276 GAGGCTCAGTCTTGTGAGGGAGG - Intergenic
1192502018 X:71660670-71660692 CAGCCTCAGTATTGTGTGGGAGG + Intergenic
1193798298 X:85904165-85904187 CTTCCTCAGGTTTATGTGGGAGG - Intronic
1194802750 X:98292167-98292189 CAGGCCCAGGGTTGTGGGTGGGG + Intergenic
1195836920 X:109126222-109126244 CAGGATAAGGTTTGTGGGGAGGG + Intergenic
1196599351 X:117584389-117584411 CAGGTTCAGGCTTGCGTGAGAGG - Intergenic
1198578450 X:138036733-138036755 CAGGCTGGGGTTGGGGTGGGGGG - Intergenic
1198821211 X:140650468-140650490 CAGGCTCAGGGCTGTTTGGGAGG - Intergenic
1200060186 X:153480608-153480630 CAGCCTCAGGCTTGTCTGGGTGG - Intronic