ID: 953044129

View in Genome Browser
Species Human (GRCh38)
Location 3:39280392-39280414
Sequence GTACTCACTGGACCACACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953044117_953044129 11 Left 953044117 3:39280358-39280380 CCTCAGCTTCCCTGCCCACGAGA 0: 1
1: 0
2: 0
3: 42
4: 267
Right 953044129 3:39280392-39280414 GTACTCACTGGACCACACTGGGG 0: 1
1: 0
2: 1
3: 12
4: 115
953044116_953044129 12 Left 953044116 3:39280357-39280379 CCCTCAGCTTCCCTGCCCACGAG 0: 1
1: 0
2: 0
3: 23
4: 259
Right 953044129 3:39280392-39280414 GTACTCACTGGACCACACTGGGG 0: 1
1: 0
2: 1
3: 12
4: 115
953044120_953044129 2 Left 953044120 3:39280367-39280389 CCCTGCCCACGAGAGGGAGCCCA 0: 1
1: 0
2: 3
3: 10
4: 142
Right 953044129 3:39280392-39280414 GTACTCACTGGACCACACTGGGG 0: 1
1: 0
2: 1
3: 12
4: 115
953044122_953044129 -3 Left 953044122 3:39280372-39280394 CCCACGAGAGGGAGCCCAGAGTA 0: 1
1: 0
2: 1
3: 2
4: 137
Right 953044129 3:39280392-39280414 GTACTCACTGGACCACACTGGGG 0: 1
1: 0
2: 1
3: 12
4: 115
953044123_953044129 -4 Left 953044123 3:39280373-39280395 CCACGAGAGGGAGCCCAGAGTAC 0: 1
1: 1
2: 0
3: 6
4: 111
Right 953044129 3:39280392-39280414 GTACTCACTGGACCACACTGGGG 0: 1
1: 0
2: 1
3: 12
4: 115
953044121_953044129 1 Left 953044121 3:39280368-39280390 CCTGCCCACGAGAGGGAGCCCAG 0: 1
1: 0
2: 4
3: 16
4: 198
Right 953044129 3:39280392-39280414 GTACTCACTGGACCACACTGGGG 0: 1
1: 0
2: 1
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953044129 Original CRISPR GTACTCACTGGACCACACTG GGG Intronic
901203124 1:7477843-7477865 GTACCCACTCGTCCACACGGCGG - Intronic
901414339 1:9106378-9106400 GGACTCACTGGAGCAGACTCGGG - Intronic
903224779 1:21888341-21888363 GTCCTCACTGGGCCAGGCTGTGG - Intronic
904045752 1:27607318-27607340 GTCCCCACTGTACCACAATGAGG - Intergenic
904361960 1:29981837-29981859 AGACTCACTGAACCACAGTGAGG - Intergenic
904777019 1:32915955-32915977 GATCTCACGGGACCACAATGTGG - Intergenic
905108928 1:35580323-35580345 CTGCTCCCTGGCCCACACTGGGG - Intronic
910843362 1:91582639-91582661 TTATCCCCTGGACCACACTGGGG + Intergenic
915475956 1:156153007-156153029 GTGCTCACTGGACCACACTTTGG - Intronic
919921722 1:202170030-202170052 GCACTCACAGGTCCACTCTGTGG - Intergenic
920296850 1:204963055-204963077 GTCCTCAAGGGACCTCACTGTGG + Intronic
920448631 1:206039612-206039634 GAACTCACTGGACCACCCAGAGG - Intronic
922413626 1:225399214-225399236 CTAGTCACTGGATCACAATGCGG + Intronic
922563328 1:226585082-226585104 TTACTGGCTGTACCACACTGCGG + Intronic
1064383849 10:14872772-14872794 GTTTTCACTGGAACCCACTGAGG - Intergenic
1067095133 10:43294882-43294904 GTGCTCAGGGGACCACACAGAGG - Intergenic
1067713976 10:48672363-48672385 GTGTTCACTGGGCCAAACTGAGG + Intergenic
1071168059 10:82829928-82829950 GTACTCACTTGTCCACCCAGGGG - Intronic
1071570359 10:86693255-86693277 GAACTCACTGGAACCCGCTGGGG + Intronic
1072629504 10:97135613-97135635 GTACTCACTGCAGCCCCCTGGGG - Intronic
1074395333 10:113093091-113093113 GTACCCAGTGGAGCAGACTGCGG - Intronic
1074449484 10:113547603-113547625 GTCATCACAGGACAACACTGAGG + Intergenic
1077439084 11:2559945-2559967 GAAGTCACTGGAACACTCTGGGG - Intronic
1081547039 11:44078861-44078883 CTACTCTCTTGACCCCACTGTGG + Intronic
1086768749 11:90733476-90733498 GTAATCACTGGACCAGCCTGAGG + Intergenic
1087640681 11:100751633-100751655 GCCCTCACTGAAACACACTGAGG + Intronic
1093053897 12:14535229-14535251 GTACTCAATGCCACACACTGAGG + Intronic
1094053408 12:26244708-26244730 TTAACCACTGAACCACACTGTGG - Intronic
1095559775 12:43551610-43551632 GCACTCCCAGGACCACACGGCGG - Intronic
1099978300 12:89569745-89569767 CTCCTCTCTTGACCACACTGAGG - Intergenic
1100713382 12:97280697-97280719 GTCAAGACTGGACCACACTGTGG - Intergenic
1101519543 12:105468746-105468768 GTACACAATGGTCAACACTGGGG - Intergenic
1109598569 13:64592164-64592186 GTTCTCACTGACTCACACTGTGG + Intergenic
1122034614 14:98938261-98938283 GGCCACACTGGACCACACTCAGG + Intergenic
1123965802 15:25456166-25456188 ATATTCTTTGGACCACACTGTGG + Intergenic
1124342538 15:28899466-28899488 GTGCTCACTCAAGCACACTGTGG - Intronic
1124638204 15:31378378-31378400 GTCCTCGCTGGAGCACACTTTGG - Intronic
1124707328 15:31976868-31976890 ATACACACTGGCACACACTGGGG - Intergenic
1126698177 15:51342745-51342767 GTACTCCCTGGAGCCCAGTGGGG - Intronic
1127971527 15:63965944-63965966 GTACTAGCTTGACCACAGTGGGG - Intronic
1128338014 15:66800849-66800871 GTGCCCACTGGACCACAGGGAGG - Intergenic
1129245971 15:74278890-74278912 GTGCCCACTGGCCCACACTGCGG + Intronic
1129697573 15:77749348-77749370 GTACTCACTGGGCCCACCTGGGG - Intronic
1131524096 15:93139009-93139031 GTAGCCACTGGACCACTGTGTGG - Intergenic
1131953797 15:97709949-97709971 TTATCCACTGCACCACACTGGGG + Intergenic
1132122648 15:99191297-99191319 GTACTCTGTGGAACACAGTGTGG + Intronic
1136453102 16:30365386-30365408 CTGCCCTCTGGACCACACTGGGG - Intronic
1136788750 16:32951684-32951706 GAACTCACTGGGTCACAGTGAGG - Intergenic
1136881063 16:33902250-33902272 GAACTCACTGGGTCACAGTGAGG + Intergenic
1142110872 16:88330547-88330569 GTTCTCACTGGCCCAGACTGTGG + Intergenic
1142240553 16:88942665-88942687 GAACTGGCTGGGCCACACTGCGG - Intronic
1203090947 16_KI270728v1_random:1213173-1213195 GAACTCACTGGGTCACAGTGAGG - Intergenic
1151540935 17:74764201-74764223 GTGCTCACTGGGCCATACTGAGG + Intronic
1152071190 17:78134543-78134565 GTACTCACAGGACAACAAGGAGG + Exonic
1152154314 17:78622840-78622862 GCAGTCCCAGGACCACACTGCGG + Intergenic
1153764938 18:8366307-8366329 GTGGTCTCTGGACCACACTGTGG - Intronic
1159283967 18:66325256-66325278 GGAGGCACTGGAGCACACTGCGG - Intergenic
1160717542 19:583237-583259 GGACTCACTTGCCCACACCGAGG + Exonic
926687174 2:15707115-15707137 GTTCTGCCTGGCCCACACTGTGG - Intronic
927508876 2:23631959-23631981 GTACTCCATGGACCTCACTCTGG - Intronic
931075662 2:58708801-58708823 GCACCCACTGCAGCACACTGAGG - Intergenic
933514714 2:83285935-83285957 GTACTTGCTGGAACCCACTGTGG - Intergenic
934112324 2:88755648-88755670 GTACTGAGTGGACCTCCCTGGGG - Intergenic
938623189 2:133078830-133078852 GTACTGACTGGCCCACACCAAGG - Intronic
938682499 2:133705674-133705696 GCACTCACGAGCCCACACTGTGG - Intergenic
939300836 2:140335716-140335738 CTACTCACTGGACCAGTCTGAGG - Exonic
941069913 2:160944327-160944349 TTAATCAGTGGTCCACACTGGGG + Intergenic
941107182 2:161367889-161367911 GTACTCACTGTTCCTGACTGTGG - Exonic
944016187 2:195041956-195041978 GTGCTCACTGGTCAACAATGGGG - Intergenic
944682469 2:202089627-202089649 GTTCTCACTGGAACACTGTGTGG + Intronic
947052929 2:226067032-226067054 GTCCTCACTAGACAACTCTGTGG + Intergenic
947713965 2:232330722-232330744 GTACTCACTGGCCCGCAAGGAGG + Exonic
948029261 2:234803028-234803050 GTACTCACATGACCAGAGTGTGG + Intergenic
948318524 2:237049790-237049812 GTACTCACTGGAACCCTCAGTGG + Intergenic
1170938999 20:20833212-20833234 GTGCCCACTGGTCCACAGTGAGG + Intergenic
1172438201 20:34945462-34945484 GTACAGACTGGGCCACACTCAGG - Intronic
1174506001 20:51018082-51018104 GTTCTCACGTGACCACCCTGAGG + Intronic
1177333356 21:19690925-19690947 GTACTCACTGGAAAACACATGGG - Intergenic
1177716604 21:24846908-24846930 GAACCCACTGGAGCCCACTGTGG + Intergenic
1178410867 21:32362761-32362783 CTTCTCACTGGGCCACAGTGTGG + Intronic
1179080511 21:38166413-38166435 GCACTGACTGGACCTCACAGAGG + Intronic
1179612565 21:42561899-42561921 GTCCTCACTACACCACACAGCGG + Intronic
1181140276 22:20799482-20799504 GTACTTCCTGGACCACTGTGTGG - Intronic
1184130643 22:42514763-42514785 GTAGTCACTGATCCACTCTGAGG + Exonic
949408059 3:3735282-3735304 GTTCTCACTGAACCAAAGTGGGG - Intronic
953044129 3:39280392-39280414 GTACTCACTGGACCACACTGGGG + Intronic
956197573 3:66668651-66668673 TTAGACACTGGACCAAACTGAGG + Intergenic
959980344 3:112509096-112509118 GAACTCACTGCAGCACACAGTGG + Intergenic
961204398 3:125069338-125069360 AGACACACTGGTCCACACTGGGG - Intergenic
964110054 3:153078525-153078547 GAATCCAGTGGACCACACTGTGG - Intergenic
965099576 3:164278629-164278651 GTACTAGCTGGGCCACAGTGAGG + Intergenic
966400933 3:179546476-179546498 GTACCAACTTGGCCACACTGAGG + Intergenic
967939381 3:194754525-194754547 GTGGTCTCTGGACCACACTTGGG + Intergenic
968627215 4:1631358-1631380 GGCCTCACTGCCCCACACTGAGG - Intronic
983296040 4:165870492-165870514 GCCCTCACTGGCCCTCACTGTGG - Intergenic
991981430 5:72235540-72235562 GTAATAAATGTACCACACTGGGG + Intronic
992787194 5:80181762-80181784 GTCCTCACTGGAGGACTCTGTGG + Intronic
992945108 5:81802301-81802323 TTACCCACTGTGCCACACTGGGG - Intergenic
994683613 5:102921526-102921548 TGACTCACTGGAGGACACTGGGG - Intronic
997613462 5:135230899-135230921 GCACTCTCTGCTCCACACTGGGG - Intronic
1001838529 5:174853150-174853172 GTGCTTAATGGACCTCACTGTGG - Intergenic
1003753147 6:9084789-9084811 GTACACACTGGATCACAATGTGG + Intergenic
1003962595 6:11222762-11222784 GTATTCACTGAAACAAACTGGGG + Intronic
1014378815 6:120713650-120713672 GTACCAGCTGGACCACAGTGAGG + Intergenic
1015470363 6:133598594-133598616 GGAGTCTCTGGACCACACTTTGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1021037950 7:15824670-15824692 GTACCCATTGGGCAACACTGAGG - Intergenic
1023510249 7:40945188-40945210 GTCCTCAGTGAAACACACTGAGG + Intergenic
1026967695 7:74450848-74450870 CTTCTCATTGGACCACAGTGTGG - Intergenic
1029485205 7:100836111-100836133 GCACCCACTGGACTGCACTGTGG + Intronic
1030447809 7:109669486-109669508 ATAGCCACTGTACCACACTGAGG + Intergenic
1033151561 7:138919116-138919138 ATACTCACTGGACCACTCCACGG - Exonic
1037245164 8:16826199-16826221 GTACTCCCTGGGCCTCACTCTGG + Intergenic
1039597747 8:38806137-38806159 GAACCCACACGACCACACTGGGG - Intronic
1048517651 8:135125167-135125189 GGACTCACTGCAGCACCCTGTGG - Intergenic
1050476272 9:6044773-6044795 GTTCTCAGTGAAACACACTGAGG + Intergenic
1051383543 9:16482789-16482811 GGACTCTCTGGACCAGACTGGGG + Intronic
1055498429 9:76879070-76879092 GTGCTCACTGGAACACACTTTGG - Intronic
1055848758 9:80599378-80599400 GAATACACTGAACCACACTGGGG + Intergenic
1059041742 9:110822461-110822483 GTACCAGCTGGACCACAGTGGGG + Intergenic
1059745460 9:117196063-117196085 GAACTCACTACACCACACTGAGG - Intronic
1186985738 X:15011639-15011661 GGACTAACTGGCCCACACTCGGG - Intergenic
1192016625 X:67338557-67338579 GGACTCTCTGGTCCACCCTGAGG + Intergenic
1192135060 X:68589322-68589344 GTACTAACTCGGCCACAGTGGGG + Intergenic
1192319928 X:70082423-70082445 GTAGTCTGTGGGCCACACTGAGG + Intergenic
1197380819 X:125736698-125736720 GTACCAGCTGGGCCACACTGAGG - Intergenic
1199864661 X:151831932-151831954 GCACTCTCTGGACCACACTTAGG + Intergenic
1200712058 Y:6494386-6494408 AGGCTCACTGGCCCACACTGTGG + Intergenic
1201021872 Y:9667585-9667607 AGGCTCACTGGCCCACACTGTGG - Intergenic