ID: 953044605

View in Genome Browser
Species Human (GRCh38)
Location 3:39283268-39283290
Sequence CCTACCACACATGAGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953044605_953044610 11 Left 953044605 3:39283268-39283290 CCACACAGCTCATGTGTGGTAGG 0: 1
1: 1
2: 2
3: 14
4: 188
Right 953044610 3:39283302-39283324 AACTTAGCATTGAGGTTTTATGG 0: 1
1: 1
2: 0
3: 17
4: 197
953044605_953044609 3 Left 953044605 3:39283268-39283290 CCACACAGCTCATGTGTGGTAGG 0: 1
1: 1
2: 2
3: 14
4: 188
Right 953044609 3:39283294-39283316 AATATTTGAACTTAGCATTGAGG 0: 1
1: 0
2: 0
3: 12
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953044605 Original CRISPR CCTACCACACATGAGCTGTG TGG (reversed) Intergenic
900096843 1:943240-943262 CCTACCGCGCCTGAGTTGTGGGG - Exonic
901643700 1:10705637-10705659 CCTGCCCCACATGGGCTGAGGGG + Intronic
902923311 1:19680054-19680076 TCTACCACCTATGAGCTCTGGGG + Intergenic
903298698 1:22362777-22362799 TCTGCCACATACGAGCTGTGTGG + Intergenic
903474764 1:23612011-23612033 CCCACCCCCTATGAGCTGTGTGG - Intronic
904380132 1:30105012-30105034 CCTAGCACAAGTGAGCTGAGTGG - Intergenic
910278100 1:85469284-85469306 CCTTCATCACATCAGCTGTGGGG + Intronic
912765551 1:112406441-112406463 TCTACCACATACTAGCTGTGAGG + Intronic
913972181 1:143423736-143423758 CCTTCCAGACCTGATCTGTGTGG - Intergenic
914066562 1:144249349-144249371 CCTTCCAGACCTGATCTGTGTGG - Intergenic
914112591 1:144717005-144717027 CCTTCCAGACCTGATCTGTGTGG + Intergenic
915455017 1:156034684-156034706 TCTACCACACCTGACCTATGGGG + Intergenic
916404111 1:164480687-164480709 CCTACCACACCTAAGCTATATGG - Intergenic
917300686 1:173570884-173570906 CCCACCACAAAGCAGCTGTGTGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
918100217 1:181366217-181366239 CCTCTCACACATGACCTCTGTGG + Intergenic
918211625 1:182356668-182356690 TCTACCACCCATTAGCTTTGGGG - Intergenic
918393845 1:184094218-184094240 CATATCACATATGAGCTATGTGG - Intergenic
921566450 1:216727421-216727443 TCTACTCCTCATGAGCTGTGTGG + Intronic
922712441 1:227844327-227844349 CCTACCCCCCATGAGTGGTGAGG + Intronic
923497478 1:234538098-234538120 CCCACCACGCATTTGCTGTGAGG - Intergenic
924019004 1:239760684-239760706 CAAACCACACATGAGCAGAGCGG - Intronic
1063520832 10:6739220-6739242 CATCCCACACATGAGCTGTGGGG + Intergenic
1063566558 10:7176438-7176460 CATACCAAAGATGAGCGGTGCGG + Intronic
1064555930 10:16547229-16547251 TCTGCCACTTATGAGCTGTGTGG - Intergenic
1064630813 10:17308917-17308939 CCTCCCACACATGTGCTGGTCGG - Intergenic
1068030363 10:51698405-51698427 CCTTCCTCACATGAGATGAGGGG - Exonic
1070992699 10:80746377-80746399 CCAACCAGGCATGAGCTGTATGG + Intergenic
1072802304 10:98400854-98400876 CCTACCACACATAGGCTGTGGGG + Intronic
1072887392 10:99290695-99290717 CCTCCCACAAATTAGCTGTGTGG + Intergenic
1073487273 10:103827460-103827482 TCCACCACCCATGAGCTGTGTGG + Intronic
1074578546 10:114694234-114694256 CAAACCACAGCTGAGCTGTGTGG + Intergenic
1074791238 10:116889613-116889635 TCTGCCACTGATGAGCTGTGTGG - Intronic
1075934916 10:126332088-126332110 TCTACCACACATCAGCTGCGGGG + Intronic
1077548936 11:3190874-3190896 CTTCCAACACATGAGCTTTGGGG + Intergenic
1080646290 11:34190325-34190347 CCTGCCACTCACGAGCTGGGTGG - Intronic
1081447055 11:43140727-43140749 CCTACCACATACTTGCTGTGTGG + Intergenic
1081648790 11:44809135-44809157 TCCACCACAGATGGGCTGTGTGG - Intronic
1083831546 11:65236775-65236797 CCTGCCACCCGTGAGCTTTGGGG + Intergenic
1085625133 11:78066007-78066029 TCTATCACTAATGAGCTGTGGGG + Intronic
1090109190 11:123886548-123886570 TCTACCACTCAGTAGCTGTGTGG + Intergenic
1090906121 11:131076077-131076099 CCTAATTCACATGAGCTCTGGGG - Intergenic
1094339850 12:29398971-29398993 GCTATCACACCAGAGCTGTGGGG - Intergenic
1100474054 12:94919421-94919443 CCTAACACTCACAAGCTGTGGGG - Intronic
1101513701 12:105415313-105415335 TCTACCACCCATGTGATGTGAGG + Intergenic
1102980940 12:117240798-117240820 TCTGCCACACACTAGCTGTGCGG - Intronic
1103379645 12:120483999-120484021 ACCACCACATTTGAGCTGTGTGG + Intronic
1104138342 12:125961953-125961975 CCTACAACACATGAGAATTGTGG - Intergenic
1104586104 12:130049236-130049258 TCCACCACTTATGAGCTGTGTGG - Intergenic
1106012837 13:25842041-25842063 CTTTCAACACATGAGCTTTGCGG + Intronic
1114530410 14:23391996-23392018 CCTACCACACAGGACCAGAGGGG - Intronic
1115282512 14:31679142-31679164 CCCATCACCCAAGAGCTGTGTGG - Intronic
1117418113 14:55516862-55516884 CCTACTACACCTAAGCTATGTGG - Intergenic
1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG + Intronic
1121313141 14:92945906-92945928 CCTGCCACCAATGTGCTGTGGGG + Intronic
1121796977 14:96743278-96743300 GCCACCACACCTGAGCTTTGGGG + Intergenic
1126910645 15:53413934-53413956 CTAACCACTCATGAGCTGTTTGG + Intergenic
1131009150 15:89002971-89002993 CCCACCAGCCATGAGATGTGTGG + Intergenic
1132696352 16:1203923-1203945 CCTCACACACAGGAGCGGTGGGG - Intronic
1140706097 16:77631876-77631898 CCTACCACACATGGGAATTGTGG - Intergenic
1143096194 17:4479760-4479782 CCTGCCACTTATGGGCTGTGTGG + Intronic
1144505715 17:15828918-15828940 CCCACCGCACATCAGCTATGGGG - Intergenic
1145169890 17:20646850-20646872 CCCACCGCACATCAGCTATGGGG - Intergenic
1145777985 17:27542900-27542922 ACCATCACACATCAGCTGTGTGG - Intronic
1146169115 17:30619499-30619521 CCTACCTCAAATGAGTTTTGAGG + Intergenic
1146170447 17:30627950-30627972 CCTACCTCAAATGAGTTTTGAGG - Intergenic
1146289487 17:31597536-31597558 CCCATCACAGAGGAGCTGTGAGG + Intergenic
1146343900 17:32043974-32043996 CCTACCTCAAATGAGTTTTGAGG - Intronic
1146460339 17:33041124-33041146 CCCACCACCCCTCAGCTGTGTGG - Intronic
1149011925 17:51865707-51865729 TCTAGCACTGATGAGCTGTGGGG - Intronic
1151675519 17:75595463-75595485 CCTGCCACTCACTAGCTGTGTGG + Intergenic
1152279288 17:79375855-79375877 CCTGCCCCACACCAGCTGTGTGG + Intronic
1152860599 17:82694743-82694765 CCTGGCTCACATGTGCTGTGGGG - Intronic
1154341978 18:13511100-13511122 CCTCACACACAGGATCTGTGAGG + Intronic
1156773330 18:40757009-40757031 CCTACCAGTCAGGACCTGTGTGG - Intergenic
1157281773 18:46351049-46351071 TCTGCCACACGTGAGCTCTGGGG - Intronic
1158192924 18:54850927-54850949 CCTCCTACTCATTAGCTGTGTGG + Intronic
1159507645 18:69357312-69357334 CCTCCCACACCTGAGCTTTCTGG + Intergenic
1163320909 19:16574121-16574143 CCTACCACCCACCAGCTGTGTGG - Intronic
1165635792 19:37338685-37338707 CCTAGCACACATGAAATGTTTGG + Intronic
1166921218 19:46230305-46230327 CCAGCCACACAAGAGATGTGGGG + Exonic
1167676797 19:50892291-50892313 CCTATAACACATGAGATGGGTGG + Intergenic
926644402 2:15273685-15273707 CCTATCACTTATCAGCTGTGTGG - Intronic
931455903 2:62409730-62409752 CCTGCCACTCATGCACTGTGTGG - Intergenic
932462120 2:71889217-71889239 CCAACCACCCATGTGATGTGGGG + Intergenic
932597477 2:73103055-73103077 ACTGGCACACAGGAGCTGTGTGG + Intronic
934176878 2:89584673-89584695 CCTTCCAGACCTGATCTGTGTGG - Intergenic
934287185 2:91659033-91659055 CCTTCCAGACCTGATCTGTGTGG - Intergenic
936966053 2:118128462-118128484 ACTACCACCCATCAGCTGAGTGG + Intergenic
937293038 2:120793478-120793500 CCTGCCTCAGATGAGCTTTGGGG + Intronic
939883492 2:147656223-147656245 TCCACCACTCATGAGCTGTGGGG + Intergenic
942040602 2:172058358-172058380 TCTACCACTTATTAGCTGTGTGG - Intronic
942261053 2:174163958-174163980 CCCACCACACATGAGGATTGTGG - Intronic
947350854 2:229243286-229243308 CCTACCACACATGGGAATTGTGG + Intronic
1168902012 20:1372843-1372865 CATACCAGACATTTGCTGTGAGG + Intronic
1169019639 20:2319841-2319863 CCTACCACCCAATTGCTGTGAGG + Intronic
1169586539 20:7091876-7091898 CCTACCTCAGATGGGGTGTGAGG + Intergenic
1172030133 20:31975970-31975992 TCTGCCACATATGAGCTGTGTGG + Intronic
1173793714 20:45844197-45844219 TCTACCACTCATTTGCTGTGTGG - Intronic
1173836761 20:46130902-46130924 CCTGCCACAGATCATCTGTGTGG + Intergenic
1174502242 20:50993895-50993917 TCTACCACACACTAGCTGGGTGG - Intergenic
1175225942 20:57444061-57444083 CCTGTCACACAGGCGCTGTGTGG - Intergenic
1175599436 20:60260774-60260796 CCCACTACATATGAGCAGTGTGG + Intergenic
1176031431 20:63014879-63014901 CCTTTCACACAGCAGCTGTGAGG + Intergenic
1176136272 20:63523372-63523394 CCCACCACACATGGCCTGGGGGG + Intergenic
1179440198 21:41388147-41388169 CTTAAAACACAAGAGCTGTGTGG - Intronic
1179678462 21:43000965-43000987 CCTACCACCATTGAGGTGTGAGG + Intronic
1182011929 22:27008235-27008257 CCTCCCACTTATGAGCTGGGTGG + Intergenic
1183087185 22:35493588-35493610 CCTTCCATAGATAAGCTGTGTGG - Intergenic
1184114814 22:42416345-42416367 CCCACCACTCATGATCTCTGTGG - Intronic
950269214 3:11600278-11600300 TCTGCCACACAACAGCTGTGAGG - Intronic
951770295 3:26248149-26248171 CCTACAAAACAGGAGCTGTTTGG - Intergenic
953044605 3:39283268-39283290 CCTACCACACATGAGCTGTGTGG - Intergenic
953703624 3:45215186-45215208 CCTGCCATGCATGAGCTGTTTGG - Intergenic
954907447 3:54074944-54074966 CCAACCAGACTTGAGCTGTATGG + Intergenic
954980669 3:54742468-54742490 CTTCCCTCAAATGAGCTGTGAGG - Intronic
955752159 3:62194404-62194426 CATACCACTCACAAGCTGTGGGG - Intronic
957241602 3:77667436-77667458 CCTGTCACAGGTGAGCTGTGTGG + Intergenic
957386614 3:79503588-79503610 CCTCCAACACAGGAGCTGTGTGG - Intronic
957656703 3:83087687-83087709 CCCACCACACAGGAACTATGTGG + Intergenic
961547702 3:127646813-127646835 TCTGCCACACACAAGCTGTGTGG - Intronic
962046571 3:131766149-131766171 CCTGCCACTCATTAGCTGTGTGG + Intronic
963009843 3:140758941-140758963 CCAAGGACACATGAGCTGTGAGG - Intergenic
964530608 3:157663771-157663793 CCTACTAGCCATGAGCTGTCAGG - Intronic
964674130 3:159258517-159258539 CTTACCACAAGTGAACTGTGAGG - Intronic
966029424 3:175326886-175326908 TTTCCAACACATGAGCTGTGGGG + Intronic
966971408 3:185048770-185048792 CCTACGTACCATGAGCTGTGAGG + Intronic
968475579 4:805194-805216 CCTTCCAAACATGGGCTCTGCGG - Intronic
969097466 4:4744414-4744436 TCTACCACTTATGGGCTGTGTGG + Intergenic
969341758 4:6546524-6546546 TCTACCACTCACCAGCTGTGTGG - Intronic
969604354 4:8194988-8195010 TCTGCCACATAGGAGCTGTGTGG + Intronic
969697553 4:8743527-8743549 CCTACAACACATGGGATTTGTGG - Intergenic
970794924 4:19899864-19899886 TCAACTTCACATGAGCTGTGTGG - Intergenic
971790266 4:31161464-31161486 TCTTCCACTCATTAGCTGTGGGG + Intergenic
974618588 4:64324841-64324863 CCTACCACACATGTGTTCTTAGG - Intronic
977658415 4:99552454-99552476 CCTACTACACATAGGCTGTATGG - Intronic
978281580 4:107022509-107022531 TCTGCTACTCATGAGCTGTGTGG + Intronic
979074178 4:116251153-116251175 CCTACCAATCATGAGCTGGAAGG - Intergenic
981691681 4:147515632-147515654 ACTAACACACATGAGCTTTAGGG + Intronic
982165660 4:152611650-152611672 TCTGCCACACATGTGCTGTGTGG + Intergenic
982449483 4:155535222-155535244 CCTTGCACACATGAGTTGTATGG - Intergenic
984424552 4:179566308-179566330 CCTACCACAATTGAACTATGAGG - Intergenic
985265233 4:188150753-188150775 CCTGCCACTGATGAGGTGTGTGG + Intergenic
987761678 5:22171671-22171693 CCTACCACTTACTAGCTGTGTGG - Intronic
988326441 5:29774586-29774608 TTTCCAACACATGAGCTGTGGGG - Intergenic
988705938 5:33726040-33726062 CCTGGCACTAATGAGCTGTGTGG - Intronic
991896464 5:71405111-71405133 CCTACCACTTACTAGCTGTGTGG - Intergenic
992494050 5:77274315-77274337 CCTGCCGCAGATGACCTGTGTGG - Intronic
992750890 5:79859531-79859553 CCCACCTCACAGGAGTTGTGAGG - Intergenic
998460464 5:142306177-142306199 TCTACCACTTATCAGCTGTGTGG + Intergenic
998540637 5:142978206-142978228 CCTACCACTCATGGCCTTTGAGG - Intronic
998723991 5:144988009-144988031 CCTGACACACATGAGCAATGGGG + Intergenic
999275692 5:150328606-150328628 TCTGCCAGACATGCGCTGTGTGG + Intronic
1006942404 6:37761745-37761767 TCTACAACACAGGAGCTGGGAGG + Intergenic
1010744699 6:79547427-79547449 CCCACCACACTTGACCTGTCTGG + Intergenic
1012609718 6:101201563-101201585 CCTACCACACATGAGCTGAGGGG - Intergenic
1015529355 6:134205952-134205974 ACAAACACACATGAGCCGTGAGG - Intronic
1016323977 6:142878939-142878961 TCTGCCACTCATGAACTGTGTGG + Intronic
1016585732 6:145682322-145682344 CCTACAACACATGAGAATTGTGG + Intronic
1017203979 6:151785510-151785532 CCTACCTCACATGCTCTGAGGGG + Intronic
1020766411 7:12327555-12327577 CCTACTACACCTGCGCTGTATGG + Intergenic
1020962865 7:14827761-14827783 TCTACAACACAGGATCTGTGTGG - Intronic
1021084379 7:16404792-16404814 TCTACCACAATTGAGCTGTCTGG + Intronic
1022034192 7:26518555-26518577 CCTACCACCCACTAGCTGAGGGG - Intergenic
1022277167 7:28866705-28866727 CCCAGCAAACAGGAGCTGTGGGG - Intergenic
1022815531 7:33910424-33910446 CCAAGCACACATGAGAAGTGTGG + Intronic
1023256256 7:38315642-38315664 CTTACCACGGATAAGCTGTGTGG - Intergenic
1023423612 7:40010716-40010738 CCTGCCACTCATCTGCTGTGCGG + Intronic
1025624243 7:63205264-63205286 CCTCCCACACATGATGTGTGTGG + Intergenic
1032604132 7:133330685-133330707 CCTACCCAACAGAAGCTGTGAGG - Intronic
1032802953 7:135331038-135331060 CCTACCACAGATGAGAATTGTGG - Intergenic
1033162216 7:139007752-139007774 TCTATCACACATGAGGTATGTGG + Intergenic
1033168231 7:139059972-139059994 CTTGCCACCCATTAGCTGTGTGG - Intronic
1034540573 7:151755459-151755481 CCCACCACACATGGCCTCTGAGG - Intronic
1035227835 7:157443329-157443351 CCATCCGCACATGGGCTGTGGGG + Intergenic
1035560144 8:598204-598226 CCACCCACGCATGAGGTGTGTGG - Intergenic
1036959408 8:13227468-13227490 CCTACCACTAATGTACTGTGTGG - Intronic
1037331859 8:17750931-17750953 CTGACCACCAATGAGCTGTGAGG + Intronic
1038707030 8:29903809-29903831 CCTCCCACATAGCAGCTGTGAGG - Intergenic
1039435555 8:37557045-37557067 TCTGCCAATCATGAGCTGTGTGG + Intergenic
1040400481 8:47045092-47045114 TCCAACACACAAGAGCTGTGTGG + Intergenic
1041988891 8:63960727-63960749 TGAACCACATATGAGCTGTGAGG - Intergenic
1043069140 8:75617117-75617139 GCCACCACACACGAGCTGAGAGG + Intergenic
1043209026 8:77487371-77487393 CCTAACACAGATGGGCTGAGTGG - Intergenic
1047311543 8:123696644-123696666 CCTCCCACCCAGGAGCAGTGAGG - Intronic
1047430770 8:124789711-124789733 GCCACCTCACAGGAGCTGTGGGG + Intergenic
1047534563 8:125707767-125707789 CCTGCCACACACAAGCTGTGTGG - Intergenic
1048474865 8:134733953-134733975 CCTAACAAACATGAGGTCTGTGG + Intergenic
1048503775 8:135002333-135002355 CCTTCCGCATTTGAGCTGTGTGG + Intergenic
1050296175 9:4207724-4207746 TCTGCTACTCATGAGCTGTGTGG - Intronic
1052749279 9:32472609-32472631 CCCCCCAGACATGAGCTGTTTGG - Intronic
1054859094 9:69931268-69931290 CCTACCACTCATGACTTTTGAGG - Intergenic
1055788765 9:79899197-79899219 CCTGAAACACATGAACTGTGTGG - Intergenic
1056183803 9:84111735-84111757 CATGCCAGACATGAGCTTTGGGG + Intergenic
1058424167 9:104862430-104862452 CCCACCCCACCTGAGCTTTGTGG + Intronic
1058764151 9:108165108-108165130 CTTACCACACAGTAGCTATGAGG - Intergenic
1060940356 9:127539865-127539887 TCTGCCACCTATGAGCTGTGTGG + Intronic
1186701936 X:12099829-12099851 CCTACCGCTTATAAGCTGTGTGG + Intergenic
1189110217 X:38281790-38281812 CCCTCCACTGATGAGCTGTGTGG - Intronic
1190431276 X:50379854-50379876 CCTTCCTCCCATGAGCTGTGAGG + Intronic
1191592046 X:62897135-62897157 CCTAACTCTCATGAGCTGAGTGG - Intergenic
1192206766 X:69101515-69101537 CCTACCACTGATAAGCTGTGTGG - Intergenic
1197096569 X:122603837-122603859 CCCACCACACAGCAGCAGTGTGG + Intergenic
1199704296 X:150410773-150410795 TCTGCCACTGATGAGCTGTGTGG - Intronic
1200305693 X:155024093-155024115 GCTACCACTCACAAGCTGTGTGG - Intronic
1201867082 Y:18667437-18667459 CCTTCCCCACTTGATCTGTGTGG + Intergenic