ID: 953045967

View in Genome Browser
Species Human (GRCh38)
Location 3:39294409-39294431
Sequence GGACCCCTAGGGTTGCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953045967_953045971 -6 Left 953045967 3:39294409-39294431 CCCAGGTGCAACCCTAGGGGTCC No data
Right 953045971 3:39294426-39294448 GGGTCCCACACAGCGTGCTGAGG No data
953045967_953045977 25 Left 953045967 3:39294409-39294431 CCCAGGTGCAACCCTAGGGGTCC No data
Right 953045977 3:39294457-39294479 CTTACCTCCCAATTCCTCACGGG No data
953045967_953045976 24 Left 953045967 3:39294409-39294431 CCCAGGTGCAACCCTAGGGGTCC No data
Right 953045976 3:39294456-39294478 CCTTACCTCCCAATTCCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953045967 Original CRISPR GGACCCCTAGGGTTGCACCT GGG (reversed) Intergenic
No off target data available for this crispr