ID: 953049400

View in Genome Browser
Species Human (GRCh38)
Location 3:39327234-39327256
Sequence CTTCCGAGTCAGGATGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953049396_953049400 29 Left 953049396 3:39327182-39327204 CCAAAGGTGAGGAACCAAGGCTT No data
Right 953049400 3:39327234-39327256 CTTCCGAGTCAGGATGTTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 110
953049395_953049400 30 Left 953049395 3:39327181-39327203 CCCAAAGGTGAGGAACCAAGGCT No data
Right 953049400 3:39327234-39327256 CTTCCGAGTCAGGATGTTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 110
953049397_953049400 15 Left 953049397 3:39327196-39327218 CCAAGGCTTGTCAGTTAACTATG No data
Right 953049400 3:39327234-39327256 CTTCCGAGTCAGGATGTTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953049400 Original CRISPR CTTCCGAGTCAGGATGTTGT GGG Intergenic
903476132 1:23620196-23620218 CCACCGAGTCTGGATGTTGTAGG + Intronic
907050571 1:51327191-51327213 CATCCCAGTCAGGATGAGGTGGG + Intronic
911571846 1:99526969-99526991 CTTCCTAGCAAGGATATTGTAGG - Intergenic
911587952 1:99712856-99712878 TTTCCCCATCAGGATGTTGTAGG + Intronic
912208895 1:107537078-107537100 CTTCAGAATCATGATGTTCTTGG - Intergenic
916602038 1:166302655-166302677 CTCCAGAGTCAGGTTGTTGCGGG - Intergenic
919833009 1:201555428-201555450 CTTCAGAGTCAAGGAGTTGTGGG - Intergenic
1067707599 10:48622044-48622066 CTTCCTAGACAGCATATTGTTGG + Intronic
1069700597 10:70422111-70422133 CTTCCCAGCCAGGCAGTTGTTGG - Exonic
1072557448 10:96531854-96531876 CTTCCCAGTAAGGATATTGATGG + Intronic
1075729313 10:124626888-124626910 CTGCCGAGTCAGGGTGTTCAGGG + Intronic
1075951477 10:126481587-126481609 CCTCTGTGTCAGGAGGTTGTTGG + Intronic
1076131591 10:128017550-128017572 ATTCCATTTCAGGATGTTGTCGG - Intronic
1077595272 11:3526592-3526614 CTGCCAAGTCAGAATCTTGTGGG - Intergenic
1079304148 11:19307773-19307795 CCTCAGAGTCAGGCTCTTGTGGG + Intergenic
1083923549 11:65792969-65792991 CTTCCGAGGGAGGCTGATGTGGG - Intronic
1084251175 11:67900570-67900592 CTGCCAAGTCAGAATCTTGTGGG - Intergenic
1084690059 11:70719916-70719938 CTTCCTAGTCAGCCTGATGTGGG - Intronic
1084821667 11:71695464-71695486 CTGCCAAGTCAGAATCTTGTGGG + Intergenic
1086411540 11:86549418-86549440 CTTTAGAGTCAGGTTGTGGTAGG - Intronic
1087899952 11:103629044-103629066 CTTCCCAGCCAGGCAGTTGTTGG + Intergenic
1088309423 11:108444473-108444495 CTTTGGTGTCAGGATGATGTTGG - Intronic
1096256033 12:50063000-50063022 CTTCCCAGCCAGGTTGCTGTGGG - Intronic
1099920089 12:88946726-88946748 CTTCCCAGTCAGGCACTTGTGGG - Intergenic
1103503395 12:121423007-121423029 CTTTGGAGTCAGGATGCTATTGG - Intronic
1106737660 13:32604559-32604581 CTTTGGTGTCAGGATGATGTTGG + Intronic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1115165977 14:30449056-30449078 CTTCAGAGCCAGGTTGTTCTGGG - Intergenic
1122196773 14:100093689-100093711 CTTCCAACTCAGGAAGTTTTAGG - Intronic
1122284162 14:100640941-100640963 CTCTGGAGTCAGGATGTGGTGGG + Intergenic
1128528184 15:68426522-68426544 CTACCGAGTCAGCATCTTGTTGG + Intronic
1129444409 15:75606757-75606779 TTTCAGGGTCAGGATGTGGTTGG + Intronic
1130908346 15:88255148-88255170 ATTCCGAGTCAGGATGGCGCAGG - Intronic
1131478082 15:92758267-92758289 CTTTGGTGTCAGGATGATGTTGG - Intronic
1132474275 16:125534-125556 CTCCCAGATCAGGATGTTGTAGG - Intronic
1132737783 16:1395608-1395630 CTTCCGAGGCAGGAGGTTCCTGG - Intronic
1133376892 16:5294568-5294590 CTGCCAAGTCAGAATCTTGTGGG + Intergenic
1136315771 16:29454053-29454075 CTTCCGAGTCCTGGTGGTGTCGG - Exonic
1136430348 16:30193395-30193417 CTTCCGAGTCCTGGTGGTGTCGG - Exonic
1138722662 16:59100041-59100063 CTTTCGTATCAGGATGATGTTGG - Intergenic
1138836785 16:60447115-60447137 CTTCAGAATCAGCATTTTGTGGG - Intergenic
1141977869 16:87529604-87529626 CATCCGGGTCAGGATTATGTGGG - Intergenic
1144448897 17:15358304-15358326 CTTCGGTGTCAGGATGATGCTGG - Intergenic
1145058075 17:19716150-19716172 CTTCCAACTCAGGCTTTTGTGGG + Intronic
1145116628 17:20216451-20216473 CTTCCGAGTAAGGAGTTTGGGGG + Intronic
1147796231 17:43045345-43045367 CTTTCTATTCAGGCTGTTGTTGG - Intronic
1150319494 17:64200616-64200638 CTTCTGAATCAGGTTGTTCTGGG - Intronic
1151492358 17:74440195-74440217 CTTCCGGGCCAGGAAGTTGAGGG - Exonic
1152309355 17:79540180-79540202 ACTCCGAGTCAGAATGTTCTTGG - Intergenic
1154976350 18:21461125-21461147 ATTCCCAGGCAGGAAGTTGTTGG - Intronic
1157297858 18:46458961-46458983 CATCTGAGTCAGGATTTTGGGGG + Exonic
1157829552 18:50844528-50844550 CTTCCAAGTGAGGATAATGTTGG - Intergenic
1158500314 18:57995025-57995047 ATTCCGAGACAGGAAGTAGTGGG - Intergenic
1160901958 19:1433214-1433236 CTTCCGGGGCAGGAGCTTGTGGG + Intronic
1161330403 19:3684089-3684111 CTTCCCAGCCAGGAGGCTGTGGG - Intronic
1162128629 19:8512293-8512315 CTTCCTGGTCAGGGTGTTGGAGG - Intronic
1167084520 19:47300170-47300192 CTTTTGAGGCAGGATGTGGTGGG - Intronic
928131531 2:28655233-28655255 CTTCAGAATCTGGATTTTGTGGG + Intergenic
929358842 2:41058747-41058769 CTTTGGTATCAGGATGTTGTTGG - Intergenic
940257532 2:151746984-151747006 CTTTTGTGTCAGGATGATGTTGG - Intergenic
943843488 2:192609759-192609781 CTTCAGAGTCAGCATATTGAAGG + Intergenic
945622286 2:212155501-212155523 CTTCTGAGTCAGCATCTTCTGGG + Intronic
946649652 2:221877476-221877498 CCTCTTAGCCAGGATGTTGTTGG + Intergenic
948564330 2:238874074-238874096 CATCCCAGGCAGGATGTTGATGG + Intronic
1171367245 20:24633683-24633705 CTTCCGAGTCAGCAGGTCTTGGG - Intronic
1177467850 21:21512540-21512562 CTTTTGAGTCAGGATGGTTTTGG + Intronic
1180723380 22:17926274-17926296 TTTCCAAGCCAGGCTGTTGTTGG - Intronic
1184623522 22:45702821-45702843 ATTCTGATTCAGGATGTTTTTGG - Exonic
953049400 3:39327234-39327256 CTTCCGAGTCAGGATGTTGTGGG + Intergenic
953993255 3:47499939-47499961 CTTCCGAGTCCTGGTGGTGTCGG + Intronic
954530333 3:51313234-51313256 CTTCCCAGTCTGGATGTTGCAGG + Intronic
957065403 3:75517944-75517966 CTGCCAAGTCAGAATCTTGTGGG - Intergenic
959004076 3:100999446-100999468 TTTTCGAGACAGGAGGTTGTTGG - Intergenic
961899181 3:130194892-130194914 CTGCCAAGTCAGAATCTTGTGGG - Intergenic
963581030 3:147126680-147126702 CTTTGGTGTCAGGATGGTGTTGG + Intergenic
966788472 3:183641679-183641701 CATGCTAGTCAGGATGTTGTTGG + Intronic
967452438 3:189642012-189642034 CTTAGGTGGCAGGATGTTGTGGG - Intronic
969471877 4:7393964-7393986 CTGCCGAGTCAGGGCGTGGTGGG + Intronic
969803653 4:9589326-9589348 CTGCCAAGTCAGAATCTTGTGGG + Intergenic
978929247 4:114290689-114290711 CTTTGGTATCAGGATGTTGTTGG - Intergenic
982700583 4:158656758-158656780 CTTTTCAGTCAGGATGTTTTTGG - Intergenic
990545683 5:56818057-56818079 TTTACGAGTCAGAATGCTGTTGG + Intronic
991091979 5:62702363-62702385 CTTCCCAGGCAGGATGCTGGGGG - Intergenic
992192354 5:74305855-74305877 CTTTGGAGTCAGGTTGATGTTGG + Intergenic
992324933 5:75651278-75651300 CTTCCAAATAAGGATGCTGTTGG - Intronic
993281023 5:85924606-85924628 TTTTGGAGTCAGGATGATGTGGG - Intergenic
993406392 5:87516570-87516592 CTTTGGTGTCAGGATGATGTTGG - Intergenic
994148076 5:96416920-96416942 CTCCTGAGTCAGGATGGTGGTGG - Intronic
997313336 5:132909441-132909463 CTTCAGAGTAAAGATGATGTTGG - Intronic
999851837 5:155549138-155549160 TTTCCCATTCAGGATGGTGTTGG + Intergenic
1011181206 6:84622952-84622974 CTTCCCTGTCATGATTTTGTAGG - Intergenic
1012345347 6:98179112-98179134 CTTCCCAGCCAGGCAGTTGTTGG + Intergenic
1013015467 6:106157056-106157078 CTTCCTAATCAGGATTTTATAGG - Intergenic
1016073102 6:139764199-139764221 CTTTAGAGCCAGGATTTTGTGGG + Intergenic
1017713681 6:157192086-157192108 ATTCCAAGTGAGGATTTTGTAGG + Intronic
1021634311 7:22676410-22676432 CTTCCGAGCCTGGAGGTTGATGG - Intergenic
1029882886 7:103835499-103835521 ATTCTGAGGCAGGATGTTGACGG + Intronic
1039370541 8:36979883-36979905 CTACCCAATGAGGATGTTGTGGG - Intergenic
1041099645 8:54383108-54383130 CTTCCAGGTCAGGAAGTTTTTGG + Intergenic
1048009509 8:130444192-130444214 CTTCCCAGTCAGGATAGTATAGG + Intergenic
1050878388 9:10670054-10670076 CTTCCCATTCAGTATGATGTTGG + Intergenic
1056937520 9:90927678-90927700 CCTCTGAGTCAGGAACTTGTTGG + Intergenic
1057175612 9:92995963-92995985 CTTTGGTATCAGGATGTTGTTGG + Intronic
1062474119 9:136719128-136719150 CCTCCGGGCCGGGATGTTGTGGG + Intronic
1062646964 9:137552676-137552698 CTTCCGAGTCCGAAGGTTCTGGG + Intergenic
1203440748 Un_GL000219v1:5866-5888 CTTTCGTGTCAGGATGGTGTTGG + Intergenic
1203511626 Un_KI270741v1:124249-124271 CTTTCGTGTCAGGATGGTGTTGG + Intergenic
1186087645 X:6007942-6007964 CTTCCATGTCAGGATGCTGTGGG + Intronic
1190676791 X:52789422-52789444 CTCCCTACTCAGGATGCTGTGGG + Intronic
1191220415 X:57982110-57982132 CTTCGGTATCAGGATGATGTTGG + Intergenic
1194970866 X:100342132-100342154 TTTCTGAGCCAGGATGATGTCGG + Intronic
1195027334 X:100890272-100890294 CTACCTAGTAAGGAGGTTGTAGG - Intergenic
1199245898 X:145603761-145603783 TTTCCCAGTCAGTATGATGTTGG - Intergenic
1201371613 Y:13270425-13270447 GTTCCTAGTAAGCATGTTGTGGG - Intronic
1202116062 Y:21469635-21469657 CTACAGAGACAGGATTTTGTGGG - Intergenic
1202256229 Y:22923427-22923449 CTTTGGTATCAGGATGTTGTTGG - Intergenic
1202409220 Y:24557180-24557202 CTTTGGTATCAGGATGTTGTTGG - Intergenic
1202461562 Y:25112898-25112920 CTTTGGTATCAGGATGTTGTTGG + Intergenic