ID: 953050202

View in Genome Browser
Species Human (GRCh38)
Location 3:39334761-39334783
Sequence GGTGCCAAACAACCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953050202 Original CRISPR GGTGCCAAACAACCACAAGC TGG Intergenic
906294791 1:44642963-44642985 GGTGCCACTCACCCACAAGGCGG + Intronic
908338182 1:63148717-63148739 GGTGGCAAAGAACCCCAACCAGG + Intergenic
909614947 1:77597204-77597226 GGTTCCCAACAACCAAAAGCTGG + Intronic
909751971 1:79172616-79172638 GGTGCCAAAGGAACAAAAGCAGG - Intergenic
913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG + Intergenic
1066802154 10:39204429-39204451 GAAGCCAAACAACTTCAAGCAGG + Intergenic
1068135732 10:52950109-52950131 GGAGCCAAACAGCTTCAAGCAGG + Intergenic
1069586110 10:69603728-69603750 GTTGCAAATAAACCACAAGCTGG + Intergenic
1070670353 10:78373299-78373321 GGACCCAAACTAACACAAGCAGG + Intergenic
1070721628 10:78761040-78761062 GGTGCCAAACAACTGAGAGCAGG - Intergenic
1073301526 10:102473891-102473913 GGTGCTGAACCACCGCAAGCAGG + Exonic
1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG + Intergenic
1076386872 10:130063410-130063432 CGTGCCAAACAACCAAAGCCGGG - Intergenic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1077190366 11:1253530-1253552 TGTTCCAAACCGCCACAAGCTGG + Intronic
1079388177 11:19999094-19999116 GGTGCCAACCAACCAGAATAGGG + Intronic
1080734188 11:34994919-34994941 GATGCCAAACATCCCCAAGTTGG - Exonic
1086253202 11:84842491-84842513 AGTTCCTAACTACCACAAGCAGG + Intronic
1092528424 12:9324992-9325014 GGAGCCAAACAGCTTCAAGCAGG + Intergenic
1093963450 12:25301026-25301048 GGTGCCACACCACCACACCCAGG + Intergenic
1095034116 12:37336340-37336362 AGTTCCAAACATCCACAAGCAGG + Intergenic
1095034229 12:37338552-37338574 AGTTCCAAACATCCACAAGCAGG + Intergenic
1096195329 12:49645871-49645893 GGTGGCGAACAACCATAGGCTGG + Exonic
1098877417 12:75880846-75880868 GGTTCCACACAACCATAAGGGGG - Intergenic
1101469016 12:104977704-104977726 GGTGACCAAGAACCAGAAGCTGG - Intergenic
1106329925 13:28730624-28730646 GGTAACAAAGTACCACAAGCTGG + Intergenic
1109287525 13:60427902-60427924 GGTAGCAAATTACCACAAGCTGG + Intronic
1109986172 13:69988353-69988375 AATGCCAAACAACCATAGGCTGG - Intronic
1113991796 14:16033763-16033785 GGTTCCAGACAACCACAATAAGG - Intergenic
1117025277 14:51613254-51613276 GGTGACAAAGAAACACAAACAGG + Intronic
1117343125 14:54808359-54808381 GGTGCCAAACAGGAACCAGCTGG - Intergenic
1125099338 15:35892019-35892041 GGAGCCAAACAATGAAAAGCAGG - Intergenic
1125856609 15:42956078-42956100 GGTGCCAAAAAAGCCTAAGCGGG + Intronic
1128364389 15:66987040-66987062 GGTCCCAAAGAAAAACAAGCTGG + Intergenic
1128591120 15:68898359-68898381 AGTGCCAAACACACACTAGCAGG - Intronic
1134317498 16:13132660-13132682 GTAGCCAAACAATCACAAGGAGG - Intronic
1135167710 16:20155497-20155519 TGTAACAAACAACCACAAACTGG + Intergenic
1136911112 16:34145330-34145352 GGTTCCAGACAACCACAATAAGG - Intergenic
1144061786 17:11589480-11589502 GGTGCCAAGCAAGCAGAACCAGG - Intergenic
1149539193 17:57455891-57455913 TGTGCCTAACACCCACACGCGGG - Intronic
1151903235 17:77031532-77031554 GCTGCCAAAGTACCACAGGCTGG - Intergenic
1152652645 17:81502709-81502731 GATTCCAAACGACCACCAGCAGG + Intergenic
1159955542 18:74516087-74516109 GGAGCCTGACAACCACAGGCAGG - Intronic
1162222064 19:9186144-9186166 GGTGGCAGACAGCCACAAACCGG - Exonic
1162225895 19:9222082-9222104 GGTGCCAAAGACTCACAAGGGGG - Intergenic
926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG + Intronic
929761799 2:44813391-44813413 TGTCCCAAATAGCCACAAGCAGG - Intergenic
931793569 2:65688264-65688286 GGTGTGAAACAGCCTCAAGCAGG + Intergenic
936968187 2:118147761-118147783 TGTAACAAACAACCACAAACTGG + Intergenic
940006556 2:149013791-149013813 GGCTCCAAACAACCAAATGCTGG + Intronic
941992782 2:171573223-171573245 CGTAGCAAACAACCACAAACTGG - Intergenic
945191679 2:207195204-207195226 GGAGGCAAACAACCACTACCAGG + Intergenic
945335541 2:208588574-208588596 GGGGACAAACCACCAGAAGCGGG + Intronic
945369085 2:208994368-208994390 GGTGAAAAACAACAACTAGCTGG - Intergenic
945374351 2:209061702-209061724 GGTGCCAAACAACTATGAGTAGG + Intergenic
1169895772 20:10503626-10503648 TGTAACAAACAACCACAAACTGG + Intronic
1170719030 20:18859272-18859294 GCTGCAAAACAACCACTTGCTGG + Intergenic
1171770078 20:29316025-29316047 GGTTCCAGACAACCACAATAAGG + Intergenic
1171906457 20:30903606-30903628 GGTTCCAGACAACCACAATAAGG - Intergenic
1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG + Exonic
1173636908 20:44567664-44567686 GGTGCACAAGAAACACAAGCTGG - Intronic
1173843365 20:46173500-46173522 GGAGCCAAGCAAGAACAAGCTGG - Intergenic
1175850019 20:62085274-62085296 TGTGACAAATCACCACAAGCTGG - Intergenic
1176430369 21:6571644-6571666 TGTGACAAACGACCACAAGCTGG + Intergenic
1179705763 21:43179106-43179128 TGTGACAAACGACCACAAGCTGG + Intergenic
1180315476 22:11273764-11273786 GGTTCCAGACAACCACAATAAGG + Intergenic
1180339870 22:11609727-11609749 GGTTCCAGACAACCACAATAAGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953123111 3:40065134-40065156 GTTGTCAAACCACCAGAAGCTGG - Intronic
953223565 3:40997121-40997143 ACTGACAAACACCCACAAGCAGG + Intergenic
956065322 3:65391428-65391450 AGTGCTAAACAAAGACAAGCTGG - Intronic
967101600 3:186220642-186220664 GGTCCCAGCCAACCTCAAGCTGG - Intronic
975380414 4:73694161-73694183 TGTGCCAAGCAACTACAAGGAGG + Intergenic
978707749 4:111735850-111735872 GGTACCAAACTAGAACAAGCAGG + Intergenic
979591764 4:122489224-122489246 GTTCCCAGACAAGCACAAGCTGG - Intergenic
984842270 4:184079588-184079610 GATAACAAACGACCACAAGCTGG + Intergenic
985682951 5:1265990-1266012 GATCCCAAACAACCCCACGCAGG + Intronic
993338531 5:86692357-86692379 GTTGCCAAACAATCACAGGCTGG - Intergenic
1001699098 5:173693944-173693966 TGTGACAAACTACCACAAACTGG - Intergenic
1006147661 6:31969068-31969090 GCTCCCAAACACCCTCAAGCAGG + Exonic
1008380481 6:50835290-50835312 TGTTCCAAACAATCACTAGCCGG + Intronic
1010655173 6:78503316-78503338 GGTGCTCAGCAACCACATGCAGG + Intergenic
1016519924 6:144935828-144935850 GGGGCCAAGCAACAAAAAGCAGG + Intergenic
1022399918 7:30027250-30027272 GGGGCCAAACAACCTTAAGCAGG - Intergenic
1024458808 7:49638622-49638644 CATCACAAACAACCACAAGCTGG + Intergenic
1025101847 7:56142206-56142228 GGTGCCAAGCAAGGAGAAGCAGG + Intergenic
1026077166 7:67182593-67182615 TGTGCCATATAACCACAAGAGGG - Intronic
1026699706 7:72629508-72629530 TGTGCCACATAACCACAAGAGGG + Intronic
1026882573 7:73916860-73916882 GCTGCCAAACACGCAGAAGCTGG - Intergenic
1027134577 7:75615139-75615161 TTTGCCATACAACCACAAGAGGG + Intronic
1032480275 7:132240502-132240524 GCTGCCAAACACCCATTAGCTGG - Intronic
1032480850 7:132245587-132245609 CCTGCAAAACAACCAAAAGCAGG + Intronic
1032721518 7:134554135-134554157 GGAGCCAAACAGCTTCAAGCAGG - Intronic
1035288835 7:157824315-157824337 GCTGCCAGAGAACCACAAGAGGG + Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1047035482 8:120933814-120933836 CCTGCCAGACATCCACAAGCAGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1050624762 9:7491110-7491132 GGTCCCCAACAACCAGAAGAAGG + Intergenic
1053487769 9:38472985-38473007 AGTGTCAAACTACCATAAGCAGG - Intergenic
1060448878 9:123718324-123718346 GTTGCCAAGCAACCAAAAGAAGG + Intronic
1061825416 9:133255680-133255702 GGTGCCCAAGAACCACCAGGCGG - Exonic
1203363764 Un_KI270442v1:239682-239704 GGTTCCAGACAACCACAAGAAGG + Intergenic
1185877868 X:3714230-3714252 GGTCCCAAACAAGCACCCGCAGG - Intergenic
1198984081 X:142429256-142429278 GGTGCCAAGCAATGACAAACAGG + Intergenic
1200182846 X:154161597-154161619 GCTGTTAAAAAACCACAAGCAGG + Intergenic
1200188500 X:154198711-154198733 GCTGTTAAAAAACCACAAGCAGG + Intergenic
1200194149 X:154235852-154235874 GCTGTTAAAAAACCACAAGCAGG + Intergenic
1200199905 X:154273655-154273677 GCTGTTAAAAAACCACAAGCAGG + Intronic