ID: 953050528

View in Genome Browser
Species Human (GRCh38)
Location 3:39338173-39338195
Sequence CAGAAGCCTACACTTTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953050528 Original CRISPR CAGAAGCCTACACTTTTTTG AGG (reversed) Intergenic
903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG + Intergenic
906462673 1:46048113-46048135 CAGCAGCTTACATTTTATTGGGG - Intronic
908381386 1:63599920-63599942 CAGGAGCATACAATCTTTTGGGG + Intronic
908911883 1:69080931-69080953 AAGAAGCCTACATTTTTCAGCGG + Intergenic
909004676 1:70261343-70261365 CAGTAGCTTAAACTTTTTTCAGG - Exonic
909276983 1:73699421-73699443 CAGAGGCCTTCACTTATTTAAGG - Intergenic
909905971 1:81195446-81195468 AAGAAGCCATCACTGTTTTGAGG - Intergenic
909965621 1:81905817-81905839 CAGAAGCTGACACATTTCTGTGG - Intronic
910810701 1:91232857-91232879 TAAAAGACTAGACTTTTTTGTGG + Intergenic
910944248 1:92571800-92571822 CAGAAACCTGCATTTTCTTGAGG + Intronic
914937063 1:151990947-151990969 CAGGAGCAGACACTTTTCTGAGG - Intronic
918192783 1:182192110-182192132 CAGAAGCCCACATTTATATGAGG + Intergenic
922299707 1:224286986-224287008 CTGAAACCTATAATTTTTTGTGG + Intronic
924358370 1:243208805-243208827 CTGTAGCCTACACTTTAGTGGGG - Intronic
1063247752 10:4240227-4240249 CACAAGCACACACTTTTTAGAGG - Intergenic
1063267530 10:4470967-4470989 TAGAAGCCTTCACTTATTTTTGG - Intergenic
1063679493 10:8173329-8173351 AAGGAGACTACACCTTTTTGTGG + Intergenic
1063700619 10:8381034-8381056 CAGCAACCTTCTCTTTTTTGAGG - Intergenic
1071731199 10:88250173-88250195 CAGAAGCCTATAGTCTATTGAGG - Intergenic
1074308023 10:112296992-112297014 GAGAAGCCCACACTATTGTGGGG - Intronic
1075432310 10:122397392-122397414 GAGAAGCAAACATTTTTTTGTGG + Intronic
1081560993 11:44216384-44216406 CAGATTCCTTCACTTTCTTGCGG + Intronic
1085298817 11:75446355-75446377 CAGAAGCATACACGTTGCTGGGG + Intronic
1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG + Intronic
1087448803 11:98291317-98291339 CAGAAGCCTAATTTTTGTTGAGG + Intergenic
1088344230 11:108804757-108804779 CCGAAGCCTTCACTTTTTGCTGG + Intronic
1088397615 11:109385932-109385954 CATAAGCCTTCACTTCTTTTGGG + Intergenic
1089824914 11:121266210-121266232 CATAAGACTGCACTTATTTGAGG - Intergenic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1096559936 12:52428869-52428891 CTGAAGCTTACAGTTTATTGGGG + Intronic
1099218776 12:79886923-79886945 TAGAAGCCAACACTTTTATTTGG + Intronic
1099336645 12:81368379-81368401 CACAAGTCAATACTTTTTTGGGG - Intronic
1100009240 12:89934162-89934184 CAGATTCCCACACATTTTTGGGG + Intergenic
1100946855 12:99794513-99794535 CAGAATCTTATTCTTTTTTGTGG - Intronic
1102645163 12:114398956-114398978 CAGAACCCGCCACTTTTTTGTGG - Intronic
1102710050 12:114917968-114917990 CAGATGCCTACATTTGGTTGTGG + Intergenic
1104254922 12:127127658-127127680 CAGAAGCCCACATTTCTATGGGG - Intergenic
1104619134 12:130297433-130297455 CACAGGCCTCCAATTTTTTGGGG - Intergenic
1104899056 12:132178378-132178400 CAGAAACCAACACTTTTCAGGGG - Intergenic
1109785229 13:67165039-67165061 CAAGTACCTACACTTTTTTGTGG - Intronic
1111026197 13:82528997-82529019 CAGAAGCCTAGCATTTTTTGTGG - Intergenic
1112956250 13:105062024-105062046 GAGAAGCATACATTTTTATGGGG - Intergenic
1115836799 14:37414997-37415019 AAGAAGACTACTCTGTTTTGGGG - Intronic
1116857397 14:49965056-49965078 CAGAATCCCACTCCTTTTTGTGG - Intergenic
1121065553 14:90960779-90960801 CTCAAGCTTACAATTTTTTGTGG - Intronic
1122016277 14:98799483-98799505 CAGAAGCTCAGACTGTTTTGAGG - Intergenic
1125746050 15:41997923-41997945 CAGGAGCCTGGACTTGTTTGGGG - Intronic
1136285261 16:29236955-29236977 CAAAACCCTACACTTGTTTCTGG + Intergenic
1137088588 16:36159802-36159824 CAGAAGACCATACTTTTTTCTGG + Intergenic
1138628816 16:58276977-58276999 CAGAAGCATACACTGTTTTTAGG - Intronic
1139427401 16:66891315-66891337 CAAAAGCCTTCACTTCTTTCAGG - Intronic
1140349430 16:74247969-74247991 GAGAAACCTCCACTTTTCTGAGG + Intergenic
1140432662 16:74917867-74917889 CTGAATCTTACACTTTTTGGTGG + Intronic
1145202071 17:20954856-20954878 GAGAAGCCTACACTCTGCTGAGG - Intergenic
1148832837 17:50446294-50446316 CAGAAAAGTACACTTTTTTTTGG + Intronic
1149263932 17:54907491-54907513 CAGTAGCCTACTCTTTTAAGAGG - Intronic
1150907995 17:69359122-69359144 GTGAAGGCTACATTTTTTTGCGG - Intergenic
1151750380 17:76033871-76033893 CAGCAGCCCACACTGTCTTGGGG + Intergenic
1154933177 18:21022157-21022179 CTATAGCCTACATTTTTTTGTGG - Intronic
1154960520 18:21303907-21303929 CAGAAGCTGACACTGTGTTGGGG + Intronic
1155035105 18:22019446-22019468 AAGAGGCCTACACTTGTTTCAGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157050526 18:44158436-44158458 AAGAAGCCAACAATTTTTTTAGG - Intergenic
1159047462 18:63382880-63382902 CAGAAGCCAACCCAATTTTGAGG - Intergenic
1160658513 19:287439-287461 CAGCAGCCTTCACTCTTGTGGGG - Intronic
1162557930 19:11399270-11399292 ACCCAGCCTACACTTTTTTGAGG - Intronic
1162577322 19:11506483-11506505 CCCATGCCTACACCTTTTTGAGG + Intronic
1164866472 19:31608403-31608425 CAGAACCATGCACTTTTTGGTGG - Intergenic
1167845518 19:52160780-52160802 GAGAAGCCTACACTGATTTACGG - Intronic
928729419 2:34213841-34213863 TAGAAGCCTTCGCTTTTTTCTGG - Intergenic
929993881 2:46812795-46812817 CACAAGCCCACACTTTTGTGGGG + Intergenic
930390128 2:50750175-50750197 CAGGAGCCTATACTATTTTGAGG + Intronic
932579963 2:72986720-72986742 AAGAAGCCTACACCTTGTTTGGG - Intronic
937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG + Intronic
938510560 2:131937707-131937729 CAGCAGTCTACACTTTATTCAGG - Intergenic
938830880 2:135049295-135049317 CAGAAGATTACATTTTTTGGGGG - Intergenic
1170174644 20:13454942-13454964 CAGAAGTCTTCACTTTGTGGTGG + Intronic
1170596429 20:17809412-17809434 CAGAAGTCTGCACTTTCTAGGGG - Intergenic
1174130224 20:48339249-48339271 CAGAAGCTGACACTGTTTTCGGG + Intergenic
1176783268 21:13225609-13225631 CAGCAGTCTACACTTTATTCAGG + Intergenic
1177980912 21:27914402-27914424 CAGTAGTCTACACTTTATTCAGG + Intergenic
950638503 3:14332926-14332948 CAGAAACCTACAATATTTTGGGG - Intergenic
950716269 3:14849851-14849873 CAGAAGCCAGCATTTTTTTTAGG - Intronic
951615594 3:24540068-24540090 CAGAAGGGTACACTTGTTTCTGG + Intergenic
953050528 3:39338173-39338195 CAGAAGCCTACACTTTTTTGAGG - Intergenic
953429259 3:42823720-42823742 AAGAAACCTATACATTTTTGCGG + Intronic
956679311 3:71763185-71763207 GAGAAGCCTACATTGTTTTTTGG + Intergenic
960039505 3:113135474-113135496 CAGAATCTTACAGTATTTTGGGG + Intergenic
960188281 3:114671389-114671411 CAGAAGCTTAAACTATTTGGGGG - Intronic
962898945 3:139740344-139740366 CAGGAGCCTGGACTTTTGTGTGG - Intergenic
963669830 3:148237171-148237193 CAGAAGCTTATATTCTTTTGAGG - Intergenic
964446743 3:156767117-156767139 CAGTAGTCTTCACTTATTTGTGG + Intergenic
964497085 3:157302748-157302770 AAGAAGCTTAGATTTTTTTGTGG - Intronic
966278115 3:178199760-178199782 CAGAATCAGACACATTTTTGAGG + Intergenic
966578110 3:181526465-181526487 CACAAACCTTCACTTTCTTGAGG + Intergenic
968981203 4:3850578-3850600 CAGGAGCCTCTGCTTTTTTGGGG + Intergenic
970363844 4:15337931-15337953 TAGTAGCCTCCAATTTTTTGAGG - Intergenic
970936418 4:21576176-21576198 TAGAAGCCTAAATTTTTTAGTGG + Intronic
972013084 4:34208852-34208874 TAGAAGCTCACCCTTTTTTGAGG + Intergenic
973730392 4:53817004-53817026 CAGAAGCCATGACATTTTTGAGG - Intronic
974126866 4:57707313-57707335 AACAAGCCTACACTTATTTTAGG + Intergenic
974445973 4:61981993-61982015 CATAAGGCTTTACTTTTTTGGGG - Intronic
976383397 4:84426864-84426886 CTGAAACCTACACTTTTCAGTGG + Intergenic
976619502 4:87114169-87114191 AAGCAACCTTCACTTTTTTGTGG - Intronic
978018195 4:103774658-103774680 CAGATGGCTACATTTGTTTGTGG + Intergenic
979243446 4:118470712-118470734 CTGTAGCCTACACTTTAATGGGG + Intergenic
981400340 4:144306645-144306667 CACAAGCATACACTCTTTTTTGG + Intergenic
982975488 4:162052759-162052781 TAAAAGCACACACTTTTTTGTGG + Intronic
984071520 4:175119969-175119991 CAGGAACCTCAACTTTTTTGAGG + Intergenic
984453838 4:179939696-179939718 CAGAATCTGACATTTTTTTGAGG - Intergenic
986168281 5:5294453-5294475 CTGAAGCCCAGACTTTTTTGGGG + Intronic
986650330 5:9957251-9957273 CAGAGACATCCACTTTTTTGTGG + Intergenic
987216409 5:15742471-15742493 CACATGCCTACACTGTTCTGGGG - Intronic
988936149 5:36084722-36084744 CATAATCCCACACTTTTTGGAGG - Intergenic
990078190 5:51877595-51877617 TAGAAGTCAACACTTATTTGTGG + Intergenic
990757549 5:59091287-59091309 CATAAGCGTACATTTTTGTGGGG - Intronic
991329059 5:65472305-65472327 AAGAAGCCTATACTTCTTAGTGG - Intronic
992665997 5:79010030-79010052 CAGAAGCCAAGACTATTTTTAGG - Intronic
993635109 5:90333577-90333599 CATATGCCTACATTTTCTTGGGG + Intergenic
996877221 5:128252741-128252763 CAAAAGCCTACTTTTTTTTTTGG + Intergenic
1000750760 5:165093822-165093844 CAGAAGTCTGCATTTTCTTGAGG - Intergenic
1001851455 5:174970453-174970475 CAGAAGCCTACATGTTTTCAAGG - Intergenic
1003525361 6:6892447-6892469 CAGAATCCTACTCTTTAGTGGGG - Intergenic
1004044034 6:12009459-12009481 CAGGAGCCCCCTCTTTTTTGGGG + Intronic
1006058248 6:31401362-31401384 CCCTAGCCTACACTTTTCTGTGG - Intronic
1006070630 6:31495573-31495595 CCCTAGCCTACACTTTTCTGTGG - Intronic
1011374061 6:86671262-86671284 CATAATCCCAAACTTTTTTGAGG + Intergenic
1014683818 6:124469760-124469782 TTGAAGCCTACACTTTATTGTGG - Intronic
1016437627 6:144053662-144053684 CCGAAGCCTAAACTTTTAGGTGG - Intronic
1016513719 6:144871078-144871100 CAGAAGCTTTCCCTTTTCTGTGG + Intergenic
1019511548 7:1420002-1420024 CAGGAGCCTCCACTGTTTGGAGG - Intergenic
1021514229 7:21465373-21465395 CAGAGCCCTACACTCTTTTCTGG - Intronic
1021820616 7:24494382-24494404 CAGCTGACTGCACTTTTTTGAGG - Intergenic
1023540644 7:41261628-41261650 AAGAAGCCTTCACGTTTTTTTGG - Intergenic
1023706338 7:42945677-42945699 CAAAATCCTAGCCTTTTTTGGGG + Intronic
1029662134 7:101969585-101969607 TAGAATCCCACACTTTTTAGCGG + Intronic
1035556317 8:569658-569680 CAGAAGCCTACATTATTTTAAGG + Intergenic
1036543883 8:9747265-9747287 AAGATGACTACATTTTTTTGAGG - Intronic
1038014212 8:23499558-23499580 CAGAGGCCTTCACTGATTTGAGG - Intergenic
1041393896 8:57373006-57373028 AAGAAGGCTAGACTTGTTTGAGG - Intergenic
1042967919 8:74375375-74375397 CATTTGCCTACACTTTATTGAGG - Intronic
1044074533 8:87802774-87802796 CAGTAACCTCCACTTATTTGTGG - Intergenic
1044134434 8:88568090-88568112 CAGAACTCTACACGCTTTTGGGG - Intergenic
1047986190 8:130236289-130236311 CTGGAGCCTACCATTTTTTGTGG + Intronic
1051316919 9:15847040-15847062 TAGAAGCTTATACTTTTCTGAGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058567193 9:106298803-106298825 CAAGAGCCTACAGTTTCTTGGGG - Intergenic
1059253027 9:112904321-112904343 CCCAGGCCTAGACTTTTTTGGGG + Intergenic
1186881826 X:13874216-13874238 AAAAAGCCTACACTTTTCTAGGG + Intronic
1190685639 X:52870350-52870372 CAGAGGCCAACATGTTTTTGAGG + Intergenic
1194656468 X:96580005-96580027 TAGAAGGTTAAACTTTTTTGTGG - Intergenic
1195449257 X:104991754-104991776 CAGGAGCTTACACTGTTGTGGGG + Intronic
1197360366 X:125494152-125494174 CAATAGACTACACTTATTTGAGG + Intergenic