ID: 953055336

View in Genome Browser
Species Human (GRCh38)
Location 3:39383460-39383482
Sequence GAGCAGAGCCGCGGAGTCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953055327_953055336 18 Left 953055327 3:39383419-39383441 CCTACGGTGCTGAAGCCTGCAGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 953055336 3:39383460-39383482 GAGCAGAGCCGCGGAGTCTGCGG 0: 1
1: 0
2: 2
3: 20
4: 231
953055326_953055336 26 Left 953055326 3:39383411-39383433 CCTCATCTCCTACGGTGCTGAAG 0: 1
1: 1
2: 1
3: 4
4: 73
Right 953055336 3:39383460-39383482 GAGCAGAGCCGCGGAGTCTGCGG 0: 1
1: 0
2: 2
3: 20
4: 231
953055333_953055336 3 Left 953055333 3:39383434-39383456 CCTGCAGCAGGGCAGGATGGGCA 0: 1
1: 0
2: 4
3: 65
4: 420
Right 953055336 3:39383460-39383482 GAGCAGAGCCGCGGAGTCTGCGG 0: 1
1: 0
2: 2
3: 20
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953055336 Original CRISPR GAGCAGAGCCGCGGAGTCTG CGG Exonic
900980219 1:6041986-6042008 GAGCAGAGCCTGGGGGTCTCGGG - Intronic
903601495 1:24544811-24544833 GAGCAGAACTGCAGAGTCAGAGG - Intergenic
905466539 1:38158513-38158535 GATCAGAGCTAGGGAGTCTGGGG + Intergenic
905636784 1:39559358-39559380 GACCAGAGCTGTGGAGTTTGTGG + Intergenic
905672249 1:39799504-39799526 GTGTGGAGCCGCGGTGTCTGTGG + Intergenic
905674711 1:39817304-39817326 GTGTGGAGCCGCGGTGTCTGTGG - Intergenic
908205629 1:61845303-61845325 GAGCTGAGCTCCTGAGTCTGTGG + Intronic
908807486 1:67946178-67946200 GAGCAGAGCCGGGGAGACTGGGG + Intergenic
912731348 1:112109114-112109136 GAGCAGAGCCTCCGTGACTGAGG + Intergenic
913439889 1:118886084-118886106 GTGCAGAGCAGTGGAGCCTGGGG + Intronic
914988532 1:152479319-152479341 GAGCAGAGGCACTGAGTCTGTGG + Intergenic
915561815 1:156692292-156692314 GAGCAGATGCGGGGAGCCTGTGG + Intergenic
916107305 1:161441294-161441316 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916108892 1:161448712-161448734 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916110480 1:161456093-161456115 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916112065 1:161463503-161463525 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916113652 1:161470884-161470906 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
920249336 1:204612906-204612928 GAACAGAGCATGGGAGTCTGGGG - Intergenic
920310450 1:205045161-205045183 GAGCAGACTCCTGGAGTCTGAGG - Intronic
924033579 1:239912265-239912287 GAGCAGAGCCGAGGGATCTAGGG - Exonic
1062910166 10:1206947-1206969 GGGCAGAGCCGCGAAGGCAGCGG + Intronic
1063276292 10:4572194-4572216 GAGGAGAGCCCTGGAGACTGAGG - Intergenic
1064028691 10:11869650-11869672 GAACAGAGCGCAGGAGTCTGGGG - Exonic
1064104094 10:12486682-12486704 AAGCAGAGCCGTGGAATTTGGGG + Intronic
1064639867 10:17404696-17404718 GAGCAGCGCAGCGGGGTCAGTGG - Intronic
1067500380 10:46798484-46798506 GAGCAGAGTCAGGGAGTTTGTGG + Intergenic
1067594249 10:47541828-47541850 GAGCAGAGTCAGGGAGTTTGTGG - Intronic
1067641358 10:48049943-48049965 GAGCAGAGTCAGGGAGTTTGTGG - Intergenic
1070151986 10:73811079-73811101 GAGCAGCGGCGCGGAGGCTGCGG + Intronic
1072039468 10:91593306-91593328 CAGCAGAGCAGGGGAGTCTGCGG + Intergenic
1073064580 10:100750507-100750529 GAGGAGCGCCGCGGAGTAGGAGG - Intronic
1075768864 10:124916984-124917006 GAGAGGAGGCGCGGAGACTGGGG - Intergenic
1076031347 10:127161707-127161729 GAGCAGAGGCGAGGAGAGTGGGG - Intronic
1076364923 10:129915617-129915639 GAGCACAGCCGCCGAGAGTGCGG + Intronic
1076589808 10:131575201-131575223 GAGCAGAGCGGGAGAGGCTGAGG + Intergenic
1077025585 11:438512-438534 CAGCAGAGTCTCGGAGCCTGAGG - Intronic
1077044422 11:538070-538092 GAGCAGGGCCGTGAAGTGTGTGG + Intronic
1077220265 11:1412651-1412673 CAGCAGAGCTGAGGTGTCTGTGG + Intronic
1078801059 11:14644271-14644293 GAGCAGCGCCGCGGCTGCTGGGG - Exonic
1080112240 11:28581366-28581388 GATGAGAGCAGCGGAGGCTGTGG + Intergenic
1083300608 11:61737951-61737973 GAGCAGAGCTGAGGAGTGAGAGG - Intronic
1083812271 11:65112509-65112531 TAGCAGAGCCGCGGCGCCTGCGG - Exonic
1083866217 11:65454923-65454945 GAGCACCGCCGCACAGTCTGTGG + Intergenic
1084296607 11:68216330-68216352 GAGCTGAGCCACAGAGGCTGGGG + Intergenic
1085305534 11:75483495-75483517 GAGCAGTGCAGTGCAGTCTGGGG - Intronic
1086004941 11:82026901-82026923 GAGTAGAGGAGCGGAGGCTGAGG - Intergenic
1086927641 11:92657438-92657460 GGGCACAGCCCCGGACTCTGAGG + Intronic
1087358246 11:97122599-97122621 GAGCATAGCCACAGATTCTGGGG + Intergenic
1088256501 11:107908403-107908425 GCGCATCGCCGCGGCGTCTGCGG - Intronic
1088686172 11:112286195-112286217 ATGCAGAGCCGAGGAGGCTGGGG + Intergenic
1089310443 11:117555017-117555039 GAGCAGAGGCACAGAGTGTGGGG - Intronic
1090096882 11:123751114-123751136 GAGCAAAGCAGAGGAGTCTGTGG - Intergenic
1091321534 11:134655694-134655716 GAGCAGTGCAGAGGAGCCTGAGG + Intergenic
1093977395 12:25438270-25438292 GATCAGAGACAAGGAGTCTGAGG - Intronic
1096521857 12:52188977-52188999 GAGCAGAGCAGTGGAATCTGGGG + Intronic
1098358308 12:69631378-69631400 GAGCAGAGGCTCTGAGTCAGGGG - Intergenic
1099354065 12:81611530-81611552 CAGCAGGGCCGTGGAGGCTGTGG + Intronic
1100403204 12:94250174-94250196 GAGCAGAGCAGAGGCTTCTGAGG + Intronic
1103342688 12:120229492-120229514 GAGCAGAGCCCAGGTGACTGAGG - Intronic
1105841255 13:24255272-24255294 GAGCAGAGCCAGGGAGCCTCAGG - Intronic
1107323698 13:39216727-39216749 CAGCAGAGCTCTGGAGTCTGGGG + Intergenic
1107804609 13:44142123-44142145 GAGCCGAGCCGAGGAGGCTTGGG - Intergenic
1108042983 13:46356785-46356807 GAGCTGAGCCGAGGAGTTTGAGG - Intronic
1109328498 13:60899563-60899585 GAGCACAGCAGCTGAGGCTGTGG + Intergenic
1109407876 13:61924592-61924614 GGGCAGAGCCCAGGAGTTTGAGG - Intergenic
1109630148 13:65034499-65034521 GTCCAGAGCCGCGGAGGGTGGGG + Intergenic
1113018120 13:105851446-105851468 GAGCAGAGGGGAGGAGTGTGCGG - Intergenic
1113430358 13:110245158-110245180 GGGAAGAGCCGGGGACTCTGGGG + Intronic
1113565218 13:111315690-111315712 CAGCACAGCCGAGGACTCTGAGG - Intergenic
1115879533 14:37899546-37899568 AAGCAGAGGCTGGGAGTCTGGGG - Intronic
1118102790 14:62625402-62625424 GAGTAGAGCCCCCCAGTCTGTGG + Intergenic
1119811397 14:77523419-77523441 GATCAGAGCTGGGGAGGCTGCGG + Intronic
1120736804 14:88062411-88062433 GAGCAGAGCCTCGGAGACGTGGG + Intergenic
1121279523 14:92688788-92688810 GCACAGAGCTGCGGGGTCTGGGG - Exonic
1121482061 14:94286610-94286632 CTGCAGACCCGAGGAGTCTGGGG + Intronic
1121779062 14:96610142-96610164 GAGCAGAAACGCTGGGTCTGAGG + Intergenic
1122802588 14:104239097-104239119 GAGCAGTGCCGCGTTGTCTTTGG + Intergenic
1122873189 14:104650751-104650773 GGGCAGAGCCGCTGGGTCTGGGG + Intergenic
1122929903 14:104928375-104928397 GAGCAGAGCTGTGGAGTCTGGGG - Intronic
1128213004 15:65915435-65915457 TGGCAGAGCCCCGGGGTCTGTGG - Intronic
1128249034 15:66152039-66152061 GAGGAGAGGCGCCGAGGCTGGGG - Intronic
1128320426 15:66689970-66689992 GTGCAGAGCCAGGGAGGCTGAGG - Intergenic
1128322285 15:66702252-66702274 GAGGAGCGCCGCGGAGTCATTGG - Exonic
1128368263 15:67020247-67020269 GAGCCCAGCCATGGAGTCTGGGG - Intergenic
1129330222 15:74823316-74823338 AGGCAGAGCCGGGGAGCCTGGGG + Intronic
1129467410 15:75731746-75731768 GAGCAGGGCCACGGACTCAGGGG - Intergenic
1131393927 15:92071655-92071677 TGGCAGAGCAGCAGAGTCTGGGG + Intronic
1132679099 16:1132449-1132471 GGGCAGAACCGCCGGGTCTGGGG + Intergenic
1132934028 16:2472084-2472106 GAGCAGGGCCACGGAGGCTGGGG - Exonic
1136297290 16:29310964-29310986 GAGCACAGCCGAGAAGCCTGTGG - Intergenic
1136625488 16:31459491-31459513 GAGAAGCGGGGCGGAGTCTGAGG + Exonic
1137579075 16:49622408-49622430 GAGCAGAGCAGGTGAGTCTGGGG - Intronic
1138563953 16:57818987-57819009 CAGCTGAGCCACGGAGTCTGGGG + Intronic
1138607533 16:58098556-58098578 GAGGAGAGCCGCGGGGGCTCTGG - Intergenic
1139720595 16:68849574-68849596 CAGCTGAGCCCCGGAGTTTGAGG + Intronic
1139775012 16:69311472-69311494 AAGCAGCGCCGCGGGGTGTGGGG + Exonic
1140550831 16:75863654-75863676 TGGCAGAGCCGCAGAGTGTGGGG - Intergenic
1141992681 16:87619665-87619687 GGGAGGAGCCACGGAGTCTGGGG + Intronic
1142058850 16:88017066-88017088 GAGCACAGCCGAGAAGCCTGTGG - Intronic
1142101648 16:88275303-88275325 GTGCAGAGCACCGGAGGCTGGGG - Intergenic
1142225695 16:88876648-88876670 GGGCAGAGCCGCCGCGCCTGCGG + Exonic
1142620121 17:1160107-1160129 GAGCAGAGCCCTGGGGTCTAGGG + Intronic
1142643091 17:1295867-1295889 GTGCACAGCCTCGGAGTCAGAGG + Intronic
1143196168 17:5078019-5078041 TATCAGACCCACGGAGTCTGTGG + Intergenic
1144576761 17:16434533-16434555 GAGCAGAGAGACGGAGTCTTGGG + Intronic
1148910395 17:50939512-50939534 AAGCAGAGACGCTGAGTTTGTGG + Intergenic
1149448439 17:56731777-56731799 GAGCAGAGCACTGGAGGCTGAGG - Intergenic
1150128900 17:62655971-62655993 TAACTGAGCCGAGGAGTCTGAGG - Intronic
1150132145 17:62675029-62675051 GAGCCCAGCTGCGGAGTCTGTGG + Intronic
1150576757 17:66437577-66437599 GAGCAGAGCCCCAGAGCCAGAGG + Intronic
1152534584 17:80943142-80943164 CACCAGGGCCACGGAGTCTGCGG - Intronic
1153836115 18:8965555-8965577 GATCAGAGCCGGGCAATCTGAGG - Intergenic
1155030411 18:21979022-21979044 GAGCAGGGCCGCTGTGTCCGTGG + Intergenic
1160412544 18:78685040-78685062 GAGCAGAGGCGCGGAATTGGAGG - Intergenic
1161473555 19:4472883-4472905 GAGCCGCGCCCCGGGGTCTGGGG + Intronic
1162122066 19:8476892-8476914 TAGCAGAGCCCAGGAGTCGGTGG - Intronic
1162433735 19:10644369-10644391 GAGCAGAGACATGAAGTCTGAGG - Exonic
1164776725 19:30858658-30858680 GAGCAGATAGGCGGAGTCTGTGG - Intergenic
1165105643 19:33468360-33468382 GAGCAAAGCTGGGGTGTCTGAGG + Intronic
1165384679 19:35503288-35503310 GAGCAGAGGCCAGGAGTGTGGGG + Intronic
1165596203 19:37012700-37012722 GAGCAGAGCCCCGCAGCCTCAGG + Intronic
1165657791 19:37549213-37549235 GAGCAGAACCGCGCAGCCTCAGG + Intergenic
1165740701 19:38203611-38203633 GAGATGAGCCGGGCAGTCTGGGG + Intronic
1167162864 19:47779075-47779097 CAGCGGAGCCCCGGAGTCGGGGG - Intronic
1167268997 19:48497780-48497802 GAGGAGAGCCCCCGAGACTGGGG - Exonic
1167821004 19:51927602-51927624 GTGCGGAGCCGTGGAGTTTGTGG + Intronic
1168140802 19:54385499-54385521 GAGCAGAGACCTGGAGGCTGTGG - Intergenic
1168157539 19:54484566-54484588 GAGCAGAGACCTGGAGGCTGTGG + Intergenic
1168378816 19:55903296-55903318 GAGCAGAGGGCCAGAGTCTGTGG + Intronic
925328722 2:3042274-3042296 GAGCAGAGCAGCAGAGGCCGCGG - Intergenic
925368412 2:3326431-3326453 GAGCAGGGCAGTGGAGGCTGGGG - Intronic
928171856 2:29009491-29009513 GGGCAGAGGCAGGGAGTCTGTGG + Intronic
929139950 2:38658165-38658187 GAGAAGAACCGGGGAGTCAGAGG - Intergenic
931241153 2:60453535-60453557 GAGCAGAGCAGCGGAGACCTGGG + Intronic
932584702 2:73020449-73020471 GAGCAGAGAAGAGGAGGCTGGGG - Intronic
934892912 2:98086734-98086756 GAGGAGAGGCGAGGAGACTGCGG - Intergenic
935949289 2:108314332-108314354 GAGCAGATCAGCTGAGACTGGGG + Intergenic
937895600 2:126974778-126974800 GACCAGGGCTGTGGAGTCTGTGG - Intergenic
941134120 2:161692122-161692144 GAAAAGAGCAGTGGAGTCTGTGG + Intronic
944676002 2:202034443-202034465 GTGCAGGGCGGCGGCGTCTGCGG + Intergenic
946087615 2:217189979-217190001 GAGCAGAGCAGGGTAGCCTGAGG - Intergenic
946191385 2:218009805-218009827 AAGGATAGCCCCGGAGTCTGTGG - Intergenic
946420493 2:219561924-219561946 GACCAGAGCCGCCGGGTCTTCGG + Intronic
946702202 2:222424800-222424822 GCGCAGAGCCGCGGCGCCGGAGG + Exonic
947769824 2:232662011-232662033 GAGGAGAGCCAGGGGGTCTGTGG + Intronic
947791310 2:232870955-232870977 GATCAGAGTGGCGGAGTCTGGGG + Intronic
948727483 2:239943981-239944003 GAGCAGAGCACCTGAGTCTGGGG - Intronic
948861130 2:240753044-240753066 GAGCAGAGCCCTGGGCTCTGGGG + Intronic
1169029113 20:2394576-2394598 GAGCAGAGCCCTGGACTGTGAGG + Exonic
1169799318 20:9498855-9498877 GAGCAGAGCTGAGGATTCTCTGG - Intergenic
1169887236 20:10413323-10413345 GAGCAGAGCTGAGGACTGTGAGG + Exonic
1170820781 20:19755122-19755144 GAGGGGAGGCGCGGAGGCTGAGG + Intergenic
1170873642 20:20231460-20231482 CAGCAGAGCCGAGGAGCCAGTGG + Intronic
1172537923 20:35688591-35688613 GAGGTGAGCCCAGGAGTCTGAGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1173754184 20:45500324-45500346 GAGCAGAGCCATGGTGTCAGTGG + Intergenic
1175950120 20:62578903-62578925 GAGCAGAGCTGGGGGGTCAGAGG - Intergenic
1176207132 20:63895273-63895295 GAGCGGAGCCGCGGAGCCGGCGG + Exonic
1176235108 20:64050302-64050324 GAGCAGGGACGCAGAGGCTGTGG + Intronic
1176679591 21:9812304-9812326 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176681015 21:9819344-9819366 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176681299 21:9820763-9820785 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176682144 21:9824983-9825005 GAGCAGATCCCCGGAGCCTCAGG - Intergenic
1176682423 21:9826392-9826414 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176682701 21:9827811-9827833 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176683261 21:9830618-9830640 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176683540 21:9832027-9832049 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176683820 21:9833430-9833452 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176684097 21:9834839-9834861 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176684377 21:9836240-9836262 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1176684663 21:9837641-9837663 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1183428276 22:37751158-37751180 GGGCACAGCCCCGGGGTCTGGGG - Intronic
1184598311 22:45527530-45527552 GAGCAGAGCCGGGTGGTCTCTGG + Intronic
1184617044 22:45645478-45645500 GGGCAGAGCAGCGGAGGCAGGGG + Intergenic
950429861 3:12944514-12944536 GAGCAGAGGCGTGGGCTCTGGGG - Intronic
953055336 3:39383460-39383482 GAGCAGAGCCGCGGAGTCTGCGG + Exonic
953789665 3:45937667-45937689 GAGAAGAGCAGCGGAGGCTGTGG - Intronic
953923939 3:46971173-46971195 GAGCTGAGCCACGGAGGATGGGG - Intronic
954698444 3:52439755-52439777 GAGCACAGACCCTGAGTCTGGGG + Exonic
954794383 3:53154182-53154204 GAGCACACCCACGGAGGCTGTGG + Intergenic
956527335 3:70179421-70179443 GAGCAGAGTTGCAGAGGCTGAGG + Intergenic
965734931 3:171810115-171810137 GCGCAGAGCCGCGCAGGCTCAGG - Intronic
966684863 3:182682814-182682836 GGGCAGAGCCGCGGGTTCCGAGG - Intergenic
968520963 4:1034549-1034571 GAGGAGAGACGCGGGGTCAGGGG - Intergenic
968549192 4:1213711-1213733 GAGCAGGGCCGTGGGGTCTGTGG - Intronic
968873743 4:3254595-3254617 GAGCAGGGCCCTGGGGTCTGTGG + Intronic
969369989 4:6725233-6725255 GAGCCGAGCCCCGGATTCGGGGG - Intergenic
969541544 4:7793743-7793765 GTGCAGAGCCTCCGGGTCTGTGG + Exonic
969723621 4:8906761-8906783 GAGCAGAGGCACGGGGCCTGAGG - Intergenic
973776066 4:54242866-54242888 GAGCAGAGCCTTGGATTCTGAGG - Intronic
978180292 4:105786459-105786481 GTGCAGTGGCGCGCAGTCTGCGG - Intronic
978531813 4:109722246-109722268 GAGCAGACCTGCAGTGTCTGTGG - Intronic
982728555 4:158931074-158931096 GAACAGAGCCTCTGAGACTGTGG - Intronic
984709512 4:182873493-182873515 GAGCAGAGCAGTGGACTCTCAGG + Intergenic
991100201 5:62783568-62783590 GAGCAAAGCTGGGGAGCCTGTGG + Intergenic
997429969 5:133830765-133830787 AGGCTGTGCCGCGGAGTCTGGGG - Intergenic
1002167943 5:177359615-177359637 GAGAGGAGCCGGGGCGTCTGTGG - Intronic
1003322971 6:5068681-5068703 AAGCAGAGGAGGGGAGTCTGGGG + Intergenic
1003825190 6:9944614-9944636 GAGCAGAGCCTCGGAAGCAGTGG + Intronic
1004934584 6:20495107-20495129 CACCAGAGCCCAGGAGTCTGAGG - Intergenic
1005847552 6:29793078-29793100 GATCTGAGCCGCCGTGTCTGCGG - Intergenic
1006031638 6:31180595-31180617 GAGCAGAGCCCCGCAGTCACTGG + Intronic
1006043076 6:31271194-31271216 GATCTGAGCCGCGGTGTCCGCGG + Exonic
1007306728 6:40912564-40912586 GAGCAGAGAGGTGGAGTGTGTGG - Intergenic
1007410102 6:41656590-41656612 AAGCAGAGCCTGGGAGCCTGTGG - Intergenic
1007548608 6:42711907-42711929 GAGCAGAGCTGCAGTGTCTTGGG - Intronic
1010662276 6:78585048-78585070 GAGCAGAGCAAAGGAGTTTGGGG - Intergenic
1011622667 6:89257475-89257497 GAGCAGCCCCACGGGGTCTGGGG + Intronic
1013433834 6:110081458-110081480 GAGCAGAGCCTCGAAGACAGTGG - Intergenic
1014724991 6:124962689-124962711 GAGCCGAGCGGCGGTGGCTGCGG + Exonic
1015912951 6:138186815-138186837 GAGAAGAGCAGCAGAGTCTAAGG - Intronic
1016280589 6:142413775-142413797 AAGCAGAGGCTCAGAGTCTGAGG - Intronic
1018959832 6:168440694-168440716 AAGGAGAACCCCGGAGTCTGGGG + Intergenic
1023000346 7:35801534-35801556 GCGCAGAGCCGCGGCCTCCGCGG + Intronic
1023831961 7:44044707-44044729 CAGCAGCGGCGCGGAGACTGCGG + Exonic
1025284456 7:57650920-57650942 GAGCAGAACCCCGCAGTCTCAGG - Intergenic
1028530315 7:91831528-91831550 GAGCAGAGCCTCTGCTTCTGAGG - Intronic
1029693567 7:102198604-102198626 CAGCAGAGCCACGGCCTCTGCGG + Intronic
1032286463 7:130541456-130541478 GAGCAGAGGAGCTGAGTCTCAGG + Intronic
1033050764 7:138002068-138002090 GAGCAGAGCCGAGGAGCCCTGGG - Intergenic
1034256277 7:149726166-149726188 GAGCAGAGCCAGGGATACTGAGG + Intronic
1034899443 7:154898469-154898491 GACCAGAGCCGCCGTGTCTGCGG + Intergenic
1035734254 8:1876364-1876386 GGGCAGGGCCGGGGAGGCTGGGG - Intronic
1037860838 8:22404576-22404598 GAGCAGAGAAGCAGAGACTGAGG + Intronic
1039837951 8:41271870-41271892 GAGAAGATCAGCTGAGTCTGGGG + Intronic
1040008687 8:42642832-42642854 GAGCAGAGCCCTGGGGGCTGAGG - Intergenic
1042125405 8:65533368-65533390 GAGCAGAGCTGCTGACTCTCAGG - Intergenic
1042336008 8:67630790-67630812 GTGCGGGGCCGCGGAGCCTGCGG - Intronic
1043645883 8:82518068-82518090 AAGCAGAGCCGCAGACACTGAGG - Intergenic
1048135025 8:131740075-131740097 GAGGAGAGCCCAGGAGGCTGAGG + Intergenic
1049040637 8:140110123-140110145 GAGCAGAGCCTGGCAGTCTAGGG - Intronic
1049112068 8:140652717-140652739 GAGAAGAGCCGGGGAGGTTGTGG - Intergenic
1049584341 8:143425956-143425978 GAGCTGAGCGGCGGATGCTGTGG + Intronic
1053344051 9:37364974-37364996 GGGCAGAGCTGGGGAGGCTGGGG - Intergenic
1054160544 9:61669836-61669858 GAGCAGAACCCCGCAGCCTGAGG - Intergenic
1055877518 9:80961348-80961370 GAGCAGAGCTGTGTAGACTGTGG - Intergenic
1059397996 9:114050771-114050793 CAGCAGAGCAGCCGAGTGTGTGG - Exonic
1059677658 9:116555269-116555291 GAGCAGAGAGGCGCAGACTGGGG - Intronic
1060737336 9:126074404-126074426 GAGCAGAGCCACGGGGGCAGTGG + Intergenic
1061438142 9:130579623-130579645 GAGCCGAGCGGCGGCGTCGGCGG + Exonic
1061712597 9:132498377-132498399 GAGCTGAGCCGCTGTGTTTGGGG - Intronic
1061892888 9:133632008-133632030 AAGCAGAACCCAGGAGTCTGTGG - Intergenic
1062569239 9:137177212-137177234 GAGCAGAGCCGCCGAGGCCAAGG + Intronic
1203664761 Un_KI270754v1:14839-14861 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1203665328 Un_KI270754v1:17655-17677 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1203665607 Un_KI270754v1:19065-19087 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1203666472 Un_KI270754v1:23291-23313 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1203666756 Un_KI270754v1:24703-24725 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1203667621 Un_KI270754v1:28930-28952 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1203667905 Un_KI270754v1:30342-30364 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1203668768 Un_KI270754v1:34569-34591 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1203669613 Un_KI270754v1:38795-38817 GAGCAGAACCCCGGAGCCTCAGG - Intergenic
1188977262 X:36690647-36690669 CAGCACAGCAGCTGAGTCTGAGG + Intergenic
1200238080 X:154478759-154478781 GGGCAGAGACGCCGCGTCTGCGG - Exonic