ID: 953055740

View in Genome Browser
Species Human (GRCh38)
Location 3:39385827-39385849
Sequence GAGGCACTGAACTTGGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953055740 Original CRISPR GAGGCACTGAACTTGGACAT GGG Intronic
901184324 1:7362705-7362727 GAGGCAGTGAACTTGGATAGAGG + Intronic
903088197 1:20883037-20883059 GAGCCACTGAACTTTAACCTTGG + Intronic
906259832 1:44378445-44378467 GAGGCTCAGAACCTGGACTTGGG - Intergenic
906885742 1:49645961-49645983 GAGGAACTGATGTTGGATATGGG - Intronic
906911163 1:49952576-49952598 GAGGTGCTGAATTTGGATATTGG - Intronic
908708685 1:66990908-66990930 GAGGCACTGTGCTTGGATGTGGG - Intergenic
909598904 1:77440721-77440743 GAGCCTCTGAACTTGAATATAGG - Intronic
915192316 1:154162084-154162106 GAGCCACTGCACCTGGCCATGGG - Intronic
916168416 1:161983058-161983080 TAGGAACTGAACTTGGACGCAGG + Intergenic
916231743 1:162547419-162547441 GAGTCACTGCACTCTGACATGGG + Intergenic
916323958 1:163536397-163536419 GAGGAACTGAAATGGGAAATTGG + Intergenic
918186364 1:182130962-182130984 GAGCCACTGCACCTGGCCATGGG - Intergenic
918852310 1:189708313-189708335 AAGGCACTGAAAATGGACAGAGG + Intergenic
920739080 1:208563155-208563177 GAGGCACTGATGTTGGACCAGGG - Intergenic
921845595 1:219876265-219876287 AAGGCACTGAACTTGGGGGTAGG + Intronic
922234987 1:223715823-223715845 CAGTCACTGAACTTGGAGACAGG - Intronic
922548065 1:226473409-226473431 CAGGCACTGTGCTTGGACACTGG + Intergenic
924153717 1:241154472-241154494 GGGCCCCTGACCTTGGACATTGG - Intronic
1064696875 10:17975691-17975713 GAGACACTGGACTTCGACAGTGG - Intronic
1065004090 10:21363584-21363606 CAGGCACTGAGCTTGGAACTGGG + Intergenic
1066098705 10:32097953-32097975 GAGGCTTTGGACTTGGACTTGGG - Intergenic
1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG + Intergenic
1071883922 10:89929126-89929148 GAGGTTCTGAACTTGGTCAGAGG + Intergenic
1072780230 10:98245709-98245731 GAGTCACTGAACATGAACAAAGG - Intergenic
1072948869 10:99835266-99835288 GAGGAACTGTACACGGACATGGG - Intronic
1073050001 10:100661263-100661285 TAGGCACTGAGCTTGGATCTGGG - Intergenic
1073854352 10:107657469-107657491 AAGGAAATGAACTTGGATATAGG - Intergenic
1074723618 10:116285261-116285283 GAGGCACACAGCTTGGAGATTGG + Intergenic
1074947663 10:118296913-118296935 CAGGCACTGTACTAGGTCATGGG - Intergenic
1075113997 10:119610715-119610737 GAGCCACTGCACTTGGCCAAAGG + Intergenic
1075219150 10:120569296-120569318 GAGGCACTGATCCTGGGAATGGG - Intronic
1075788908 10:125069331-125069353 GAGCCACCGCACTTGGCCATAGG - Intronic
1077942980 11:6863411-6863433 GAGTAACTGAACTTGGAGAGTGG - Intergenic
1079452783 11:20611618-20611640 GAGCCACTGAACAAGGAGATAGG - Intronic
1081245127 11:40756505-40756527 GAGGCAGTGTACTTGGATATAGG - Intronic
1081685882 11:45042695-45042717 GAGTCACTCATCTTGGGCATTGG - Intergenic
1081729550 11:45360506-45360528 GGGGCACTGAGATTGGACACTGG - Intergenic
1083408672 11:62476524-62476546 GAAGAACTCAACATGGACATTGG + Intronic
1084010505 11:66345915-66345937 GAAACACTGGACTTGGATATGGG - Exonic
1084670430 11:70603617-70603639 GAGGTACTGAGCTGGGACCTCGG + Intronic
1084767556 11:71322608-71322630 GAGGCACTGCATTAGGAAATGGG - Intergenic
1085972228 11:81606987-81607009 GAGAGCTTGAACTTGGACATGGG - Intergenic
1086168504 11:83808297-83808319 AAGGCACTGAACTTGGCCACAGG - Intronic
1090161743 11:124502430-124502452 GAGCCACTGCACCTGGCCATGGG - Intergenic
1090633807 11:128675302-128675324 GATGCCTTGATCTTGGACATCGG + Intergenic
1091949520 12:4581234-4581256 AAGACACTGAAGTGGGACATGGG + Intronic
1092782758 12:12002635-12002657 CAGGCACTGAACTGGGCCCTGGG + Intergenic
1094831012 12:34300293-34300315 GTGGCAGAGAACTTGGACCTGGG + Intergenic
1096038772 12:48495721-48495743 GAGTCACTGTACTTAGACACAGG - Intronic
1096523523 12:52197469-52197491 GGAGCACTGAACCTGGACTTAGG + Intergenic
1099544348 12:83958049-83958071 GAGGCAAAGAGATTGGACATGGG + Intergenic
1100589329 12:96010834-96010856 GTGATACTGAACTTGGACAGTGG + Intronic
1100659146 12:96678061-96678083 AAGGCACTGGACTTGAACACCGG + Intronic
1102753761 12:115320214-115320236 GAAGCACTGATCTTGGCCATTGG + Intergenic
1103313743 12:120034425-120034447 GGGGCACTGAGCTTGAACAGAGG + Intronic
1103512244 12:121483386-121483408 GAGCCACTGCACCTGGCCATAGG - Intronic
1103715059 12:122940339-122940361 GATGCCCTGACCTTGGACACAGG + Intronic
1105816551 13:24041404-24041426 GAGTCATTTAATTTGGACATAGG - Intronic
1106169256 13:27274796-27274818 GAAGCACTGAACTAGAAGATTGG - Intergenic
1106555538 13:30805348-30805370 GCGGCCATGAACTTGGACCTTGG + Intergenic
1106858133 13:33874906-33874928 GAAACATTGAACTTGGAGATAGG + Intronic
1107952409 13:45475486-45475508 GAGCCACTGAACCCGGTCATTGG + Intronic
1113439374 13:110315749-110315771 GATGCCCTGAACTTGGACTGTGG - Intronic
1114806867 14:25847631-25847653 GAGGCACTGGGCTAGGATATGGG + Intergenic
1115737530 14:36349829-36349851 GAGGCACTGAAGCTGGCCTTTGG - Intergenic
1118478440 14:66140911-66140933 AAGGCACTGAGCGTGGACAGAGG + Intergenic
1118567044 14:67153014-67153036 GAGCCACTGCACCTGGACTTTGG - Intronic
1119652765 14:76395276-76395298 TAGGTACTGACCTTGGACACAGG - Intronic
1121710368 14:96033481-96033503 CAGGCACAGAGCTTGGAAATGGG + Intergenic
1123020930 14:105397635-105397657 GAGGCACTGAACCAGGACACTGG - Exonic
1127963834 15:63909285-63909307 GAAGCACTGGAATTGAACATTGG - Intronic
1128761960 15:70223204-70223226 GAGTCACAGAACTTGGTGATGGG - Intergenic
1129622405 15:77160391-77160413 GAGCCACTGAACCTGGCCAGGGG - Intronic
1131542785 15:93288813-93288835 GAGGCGCTGGGCTTTGACATGGG + Intergenic
1134803972 16:17108993-17109015 GAGGCACTGAAGCTGCACAATGG - Exonic
1135279271 16:21139820-21139842 GAGCCACTGCACTTCGGCATGGG - Intronic
1145231532 17:21176910-21176932 GGGGCACTGAACATTTACATAGG + Intronic
1146094426 17:29914703-29914725 GATGCAATGAACTTTTACATTGG - Intronic
1152452869 17:80394142-80394164 AAGGCACTGGACTTGGACCAGGG + Exonic
1153694478 18:7626612-7626634 GGGGCACTGAAATTGTACACAGG - Intronic
1155177375 18:23312775-23312797 GCGGCACTGACCTTGGTCCTGGG - Intronic
1156154619 18:34287302-34287324 GAGAGACTGGACTTGGACTTGGG - Intergenic
1156887670 18:42154420-42154442 GAGGCACTGTGCTAGGGCATAGG - Intergenic
1157395748 18:47339543-47339565 GTGGCACATAACTTGGACACAGG - Intergenic
1158689896 18:59650809-59650831 GGGGCTCTGAAGTTGGAAATAGG + Intronic
1158751043 18:60261413-60261435 GAGGCACTGAATCTAGAGATGGG + Intergenic
1159042197 18:63334727-63334749 TAGGCACTGTACTTGCTCATGGG - Intronic
1161481549 19:4513307-4513329 GGGGCAGTGAACTTGGCCAAAGG - Exonic
1163116931 19:15194669-15194691 GAGCCACCGCGCTTGGACATGGG - Intronic
1163598140 19:18232318-18232340 GAGACACTGCACTTGTACCTGGG + Intronic
1163743381 19:19030634-19030656 GAGCCACTGCACTTGGTCAGGGG - Intronic
1163985025 19:20938026-20938048 GAGGCACTTATTTTGGAGATGGG + Intronic
1164279029 19:23752048-23752070 AAGGCACTTAATTTGGAGATTGG - Intronic
1164861614 19:31566211-31566233 GAGCCACTGTACTGGGGCATAGG + Intergenic
1165306530 19:35006039-35006061 GAGCCACTGCACCTGGCCATGGG - Intronic
1165473053 19:36014445-36014467 TAGGAACTGAACCTGGCCATTGG + Intergenic
1166745056 19:45137852-45137874 GAGCCACTGTACTTGGTCCTTGG - Intronic
927518151 2:23683732-23683754 GAGAGACTCAACTGGGACATGGG + Intronic
928159296 2:28907336-28907358 GAGCCACTGCACTTGGCCAATGG - Intronic
931189098 2:59982481-59982503 GAGGCACTGGTCTTGGACTCTGG - Intergenic
932038120 2:68269392-68269414 TAGCCACTGCACTTGAACATGGG + Intergenic
934749667 2:96785350-96785372 GAGCCACTGCACCTGGACTTCGG - Intronic
934957295 2:98633100-98633122 GGGGCAGTGAGCTAGGACATCGG + Intronic
935312923 2:101803108-101803130 TAGGCATTGAATTTGCACATTGG - Intronic
936511804 2:113154317-113154339 GAGGCCCTGAACTTACACAGGGG + Intergenic
938188240 2:129252399-129252421 GAGGGACTGTGCTTGGCCATTGG - Intergenic
938368053 2:130750988-130751010 GAGGCACTGTACTTGGCATTGGG - Intergenic
941492859 2:166163870-166163892 GAGGCACTTAACTAGTACCTGGG - Intergenic
941504840 2:166329756-166329778 AAGGCACCTAACTTGGACTTAGG + Intronic
944563516 2:200964434-200964456 GAAGCACTGAATATGGAGATGGG + Intergenic
944772693 2:202930456-202930478 GAATTTCTGAACTTGGACATAGG - Intronic
945258727 2:207824674-207824696 TACACACTGAACGTGGACATCGG - Intergenic
947636139 2:231681469-231681491 GAGGGACTGAACTTTGACCAGGG + Intergenic
1168756556 20:322454-322476 CAGGCAGTGAACTTGGAACTGGG - Intergenic
1168873867 20:1156175-1156197 GAGTCAGTGAACTTGAAGATAGG + Intronic
1171123425 20:22583706-22583728 GAGGCACTGAACGGGGCAATAGG + Intronic
1171152176 20:22837002-22837024 GAGTCACTGAACTGGGCCAAGGG - Intergenic
1172168970 20:32917452-32917474 GAGGCATTGAAGTTGAAGATGGG - Intronic
1178198887 21:30379948-30379970 GAGACTTTGAACTTGGACTTTGG + Intronic
1178973303 21:37200452-37200474 GAGGCACTGAACACTGACACGGG - Intronic
1179970501 21:44834609-44834631 GGGGCACTGACCTAGGACATAGG + Intergenic
1180035489 21:45245955-45245977 GGGGTACTGACCTTGGACTTGGG - Intergenic
1180845114 22:18976567-18976589 GAGACTCTGGGCTTGGACATTGG - Intergenic
1181045045 22:20210453-20210475 GAGGAAGTGAGCCTGGACATGGG - Intergenic
1181237428 22:21456054-21456076 GAGCCACTGCACCTGGCCATGGG - Intergenic
1181478862 22:23185021-23185043 GGGGCCCTCAACTTGGAAATGGG - Intronic
1183488465 22:38103576-38103598 GAGCCACTGCACCTGGCCATTGG - Intronic
1184011969 22:41755803-41755825 CAAGCACTGAACTTGGAATTAGG + Intronic
949322048 3:2822210-2822232 GAAGCACTGAATTTGGACTCTGG + Intronic
949332394 3:2936844-2936866 TGGGCACTGAAATTTGACATCGG - Intronic
950991519 3:17443243-17443265 GAGGCACTGAAATGTGACAGCGG + Intronic
951853788 3:27171629-27171651 CAGGTACTGATCTTGGACCTGGG - Intronic
953055740 3:39385827-39385849 GAGGCACTGAACTTGGACATGGG + Intronic
953981152 3:47413781-47413803 AATGCACTGAACCTGGACTTGGG - Exonic
956060092 3:65340476-65340498 GAGGCTCAGAACCTGGCCATGGG + Intergenic
958157824 3:89776976-89776998 GATGCAATGAACTTTTACATTGG - Intergenic
961168685 3:124780634-124780656 GAGACACTGACCGTGGGCATGGG - Intronic
961621831 3:128230437-128230459 GAGCCACTGTACTTGGCCACTGG + Intronic
962061017 3:131927573-131927595 CAAGCACTGAACTTGGCAATGGG - Intronic
963327151 3:143875492-143875514 GTGGCAATGAACCTGAACATGGG + Intergenic
967073583 3:185982816-185982838 GAGGCACAGAAGGTGGAAATAGG + Intergenic
967890243 3:194359652-194359674 GAGGGACTGGCCTCGGACATTGG + Exonic
969272815 4:6114352-6114374 GAGGACCTGAAGCTGGACATTGG + Intronic
970618306 4:17789338-17789360 TAGGCACTGACCTTGGCCTTTGG + Intergenic
971057571 4:22930954-22930976 GGGTTACTGAACTTGGACAATGG + Intergenic
973549479 4:52018851-52018873 AAGGCATTGAACTTGGAACTGGG - Intergenic
974827611 4:67151173-67151195 CACACACTGAACTTGAACATTGG + Intergenic
974868667 4:67611176-67611198 GAGCCACTGCACTTTGACCTGGG + Intergenic
977251068 4:94689367-94689389 GAGGGACTGCACTTGGCTATGGG + Intergenic
977844255 4:101747951-101747973 GAGTCACTGATCTGGCACATAGG + Intronic
978084707 4:104636454-104636476 GAGGACCTGAACTGGGACATAGG - Intergenic
978281768 4:107025228-107025250 GGGGCACTGTGCTTGGAGATCGG - Intronic
979931058 4:126631170-126631192 GAGGCAGAGTACTTGGACTTGGG + Intergenic
984399976 4:179250461-179250483 GAAGCACTGAACCTTAACATTGG + Intergenic
985929654 5:3047115-3047137 GAGGCAGTGTTCTGGGACATGGG + Intergenic
986071893 5:4293567-4293589 GAGTCACAGCACTTGGAAATAGG + Intergenic
986170680 5:5311999-5312021 GAGCCACTGCACTCGGCCATCGG + Intronic
987965168 5:24863188-24863210 GAGGTACTGACCTAGGACACAGG + Intergenic
989035494 5:37167492-37167514 GAGCCACTGCACTTGGCCAGAGG - Intronic
989618710 5:43363706-43363728 GAGCTACTGAAATTGGAGATAGG - Intergenic
990815277 5:59777677-59777699 AAGGCAATTAACTTGGACACAGG + Intronic
993356757 5:86922452-86922474 CAGGTACTGAACTCGGACAGTGG - Intergenic
996218705 5:120901393-120901415 GAGGCATTGAGCGTGGCCATTGG - Intergenic
996985457 5:129557311-129557333 GAGCCACTGTGCTTGGCCATGGG - Intronic
998032381 5:138882188-138882210 GGGACACTGAACTTGAACTTAGG + Intronic
998722338 5:144967369-144967391 GAATCACTGAACTTGAAGATGGG + Intergenic
1000475411 5:161700561-161700583 CAGGCACTGAAATTGACCATTGG + Intronic
1000625122 5:163529649-163529671 GAGCCACTGAGCCTGGACAGAGG - Intergenic
1000797374 5:165681749-165681771 GAGTCAGTGAACTTGAAGATAGG - Intergenic
1002457973 5:179356460-179356482 GACTCACTGACCTTGGACCTTGG + Intergenic
1003936292 6:10978081-10978103 AAGGCACTGAATTTGGCCCTTGG - Intronic
1006415197 6:33899543-33899565 GAGCCACTTAACTTGGCCATCGG - Intergenic
1007239896 6:40417298-40417320 GAGGCACTGAGCATGGAGACAGG - Intronic
1012171373 6:96020800-96020822 GAGGCATTGATCTTAGGCATTGG + Intronic
1012840331 6:104321443-104321465 CATGCTCTGAACTTGGGCATGGG + Intergenic
1014382792 6:120764556-120764578 GATGCCCTGAACTGGGACAGTGG + Intergenic
1015411195 6:132895585-132895607 AAGGCCCTGACCTTGGACCTGGG - Intergenic
1015836599 6:137426819-137426841 GAGAAACTGAACTTGGATAGTGG + Intergenic
1016547141 6:145237095-145237117 AAGGCAATGAACTTTGAAATGGG + Intergenic
1017648364 6:156559395-156559417 GAGGCAGTGATATTGGAGATGGG - Intergenic
1019888799 7:3928719-3928741 GAGGTACTGAACCTGGTCCTAGG - Intronic
1021213204 7:17882241-17882263 AAGTCACTGAACATGGAAATAGG - Intronic
1021225705 7:18023527-18023549 GAGGCACTGTACCTGGCCAAAGG - Intergenic
1021278932 7:18692435-18692457 GAAACACTGACCTAGGACATAGG + Intronic
1022060026 7:26784095-26784117 GAGGCACTAACCTTGGGCACAGG + Intronic
1024502548 7:50127319-50127341 GAGGAAATGATCTAGGACATTGG + Intronic
1024562739 7:50658193-50658215 CACTCACTGAACGTGGACATTGG - Intronic
1029876070 7:103753042-103753064 CAGTCACTGAAATTGGACTTGGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1032017443 7:128389038-128389060 GAGGCAGGGAACCTGGACAGAGG - Intergenic
1032101041 7:128977878-128977900 GAGGCACTGCACCTGGCCAGGGG + Intronic
1033975185 7:147092202-147092224 AAGGAACTGAACTTGGAAACAGG - Intronic
1036685447 8:10906354-10906376 TAGGCACTGAATTTGGAGACAGG - Intronic
1036723389 8:11199721-11199743 GAGGGACTGAACTGGGACACGGG + Intronic
1037489378 8:19383283-19383305 GAATCACTGAACTTGAAGATAGG - Intronic
1038766018 8:30428303-30428325 GAGCCACTGCACCTGGCCATGGG + Intronic
1039146540 8:34453277-34453299 GAAGCACTGAAATTGGACATAGG - Intergenic
1039406205 8:37314899-37314921 GAGCCACTGCACCTGGTCATCGG - Intergenic
1040493650 8:47947480-47947502 GAGGCACTGTGCCTGGCCATGGG - Intronic
1041521720 8:58764229-58764251 GAGGCACTAAACTGGCAGATGGG + Intergenic
1042238267 8:66637305-66637327 GAGCCACTGAACTCCAACATGGG + Intronic
1042575960 8:70219106-70219128 GAGGGACAGCACTGGGACATAGG + Intronic
1043094800 8:75953816-75953838 GATTCACTGAAGCTGGACATGGG + Intergenic
1043698510 8:83252080-83252102 AAGGCACTGAAAGTGGACAGAGG - Intergenic
1048411512 8:134179099-134179121 GAGTCAGTGAACTTGAAGATAGG - Intergenic
1048775098 8:137936758-137936780 GAGGCAATGAAATAGGACACTGG + Intergenic
1050448022 9:5747465-5747487 TAAGCACTTTACTTGGACATCGG + Exonic
1051388140 9:16532831-16532853 GAGTCACTGAACATGGAGTTGGG - Intronic
1052408943 9:28098018-28098040 GAGCCACTGCACCTGGACTTTGG - Intronic
1054759449 9:68991632-68991654 GAGGCGCAGAACTGGGTCATGGG + Intronic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1057947899 9:99345537-99345559 GAAGCACTGAACTTGGAATAGGG - Intergenic
1058668105 9:107338667-107338689 GAGGCACTGCACTTGATCGTGGG - Intergenic
1059788058 9:117608239-117608261 CAGGCACTGTACTAGTACATGGG - Intergenic
1060096807 9:120798259-120798281 AAGGCACTTGTCTTGGACATTGG - Intergenic
1061508872 9:131048578-131048600 GAGGCACTGAACTGGCACTGGGG + Intronic
1185596310 X:1308941-1308963 GAGCCACTGCACCTGGCCATGGG - Intronic
1185885201 X:3776255-3776277 GAGCCACTGCACCTGGCCATAGG + Intergenic
1188743917 X:33817940-33817962 AAGGCACTGAAAGTGGACAGAGG - Intergenic
1188993066 X:36847730-36847752 CAAGCACTGAACATGGAAATTGG + Intergenic
1189232362 X:39462463-39462485 GAACCACTGAACTCGGACAAAGG + Intergenic
1189287034 X:39858922-39858944 CAGGCATTGAACTGGGACTTGGG - Intergenic
1190242553 X:48668710-48668732 GAGGCACAGAACTTGAACCCAGG + Intergenic
1190817325 X:53939814-53939836 GAGGCAGTCAAATAGGACATGGG - Intronic
1191137535 X:57082349-57082371 AAGGCACTGAGGTTGGACAGAGG + Intergenic
1193959986 X:87913998-87914020 AAGGCACTGAGATTGGACAGAGG + Intergenic
1195541611 X:106068736-106068758 AAGGCACTGAAAGTGGACAAAGG - Intergenic
1197186272 X:123590634-123590656 GAGACACTGCACTTGGTCCTGGG - Intergenic
1198791491 X:140351763-140351785 CATGCTATGAACTTGGACATTGG - Intergenic
1200075317 X:153547796-153547818 CAGGCACTGACCTTGGCCATGGG + Intronic