ID: 953060214

View in Genome Browser
Species Human (GRCh38)
Location 3:39421728-39421750
Sequence CTGTTAGTATGGAAGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953060214_953060219 16 Left 953060214 3:39421728-39421750 CCTCCTTTCTTCCATACTAACAG No data
Right 953060219 3:39421767-39421789 CTGAGCACAGGCTGAAAAGCTGG No data
953060214_953060218 4 Left 953060214 3:39421728-39421750 CCTCCTTTCTTCCATACTAACAG No data
Right 953060218 3:39421755-39421777 TGTGAGTTTTCACTGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953060214 Original CRISPR CTGTTAGTATGGAAGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr