ID: 953061856

View in Genome Browser
Species Human (GRCh38)
Location 3:39434367-39434389
Sequence CTCAGTCCTCAGGTTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953061853_953061856 -6 Left 953061853 3:39434350-39434372 CCCAAGTTGCTTACTTTCTCAGT No data
Right 953061856 3:39434367-39434389 CTCAGTCCTCAGGTTTTCACAGG No data
953061851_953061856 3 Left 953061851 3:39434341-39434363 CCAACAGGCCCCAAGTTGCTTAC No data
Right 953061856 3:39434367-39434389 CTCAGTCCTCAGGTTTTCACAGG No data
953061852_953061856 -5 Left 953061852 3:39434349-39434371 CCCCAAGTTGCTTACTTTCTCAG No data
Right 953061856 3:39434367-39434389 CTCAGTCCTCAGGTTTTCACAGG No data
953061850_953061856 4 Left 953061850 3:39434340-39434362 CCCAACAGGCCCCAAGTTGCTTA No data
Right 953061856 3:39434367-39434389 CTCAGTCCTCAGGTTTTCACAGG No data
953061854_953061856 -7 Left 953061854 3:39434351-39434373 CCAAGTTGCTTACTTTCTCAGTC No data
Right 953061856 3:39434367-39434389 CTCAGTCCTCAGGTTTTCACAGG No data
953061848_953061856 22 Left 953061848 3:39434322-39434344 CCTGGAGAGGTGACTTTGCCCAA No data
Right 953061856 3:39434367-39434389 CTCAGTCCTCAGGTTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953061856 Original CRISPR CTCAGTCCTCAGGTTTTCAC AGG Intergenic
No off target data available for this crispr