ID: 953061929

View in Genome Browser
Species Human (GRCh38)
Location 3:39434747-39434769
Sequence AGTATTGGCGGGGATACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953061929_953061943 24 Left 953061929 3:39434747-39434769 CCCTCTGTATCCCCGCCAATACT No data
Right 953061943 3:39434794-39434816 CATAGTAGAAGGGGAGGGTGTGG No data
953061929_953061938 13 Left 953061929 3:39434747-39434769 CCCTCTGTATCCCCGCCAATACT No data
Right 953061938 3:39434783-39434805 TGTGACTCACTCATAGTAGAAGG No data
953061929_953061940 15 Left 953061929 3:39434747-39434769 CCCTCTGTATCCCCGCCAATACT No data
Right 953061940 3:39434785-39434807 TGACTCACTCATAGTAGAAGGGG No data
953061929_953061941 18 Left 953061929 3:39434747-39434769 CCCTCTGTATCCCCGCCAATACT No data
Right 953061941 3:39434788-39434810 CTCACTCATAGTAGAAGGGGAGG No data
953061929_953061944 28 Left 953061929 3:39434747-39434769 CCCTCTGTATCCCCGCCAATACT No data
Right 953061944 3:39434798-39434820 GTAGAAGGGGAGGGTGTGGTTGG No data
953061929_953061942 19 Left 953061929 3:39434747-39434769 CCCTCTGTATCCCCGCCAATACT No data
Right 953061942 3:39434789-39434811 TCACTCATAGTAGAAGGGGAGGG No data
953061929_953061939 14 Left 953061929 3:39434747-39434769 CCCTCTGTATCCCCGCCAATACT No data
Right 953061939 3:39434784-39434806 GTGACTCACTCATAGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953061929 Original CRISPR AGTATTGGCGGGGATACAGA GGG (reversed) Intergenic
No off target data available for this crispr