ID: 953066754

View in Genome Browser
Species Human (GRCh38)
Location 3:39480287-39480309
Sequence CTGCTCCCAGAACCTAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953066754_953066755 10 Left 953066754 3:39480287-39480309 CCTATTCTAGGTTCTGGGAGCAG 0: 1
1: 0
2: 0
3: 24
4: 211
Right 953066755 3:39480320-39480342 AAAAATTTTCTCTACCCCAGAGG 0: 1
1: 0
2: 2
3: 22
4: 296
953066754_953066756 11 Left 953066754 3:39480287-39480309 CCTATTCTAGGTTCTGGGAGCAG 0: 1
1: 0
2: 0
3: 24
4: 211
Right 953066756 3:39480321-39480343 AAAATTTTCTCTACCCCAGAGGG 0: 1
1: 0
2: 3
3: 19
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953066754 Original CRISPR CTGCTCCCAGAACCTAGAAT AGG (reversed) Intronic
900089432 1:913408-913430 CTGCACCCAGAGCCTCCAATGGG - Intergenic
900801759 1:4741367-4741389 CAGCTCCCAGAAGCTGGAAGAGG - Intronic
901028355 1:6291392-6291414 CTGCTCCCAGAAGCTGGAAGGGG + Intronic
901685682 1:10942168-10942190 CTGCTCCCGGGACCTAGTATCGG + Intergenic
901718860 1:11179003-11179025 CTTTTCCCTGAACCCAGAATGGG - Intronic
902188339 1:14742215-14742237 CTGTTCCCAGCATCTAGAAGAGG + Intronic
902619012 1:17639780-17639802 CTGTTCCCAGCACCTGGCATGGG - Intronic
902952468 1:19897076-19897098 CTTCTCCCAAGACCTAGAAAGGG - Intronic
903939532 1:26919905-26919927 TTGCTCCCAGTGCCTAGGATGGG + Intronic
906859930 1:49348567-49348589 CTGCTACCAGAAGCTGGAAGAGG + Intronic
909307046 1:74094477-74094499 CAGCTTCCAGAAACTAGACTAGG + Intronic
909525611 1:76619137-76619159 CTTCTCCCAGAAGCTTCAATAGG + Intronic
914984948 1:152448440-152448462 GTATTCCCAGAACCTAGAACAGG - Intergenic
918516506 1:185369506-185369528 TTACACCCAGAACCTGGAATGGG + Intergenic
920366011 1:205448763-205448785 CTGCTGCCAGTACCCAGGATGGG + Intronic
921374592 1:214460768-214460790 CTGCTCCCAGAAACCAGATAGGG - Intronic
924870468 1:248038313-248038335 CTGTTCCCACAATCAAGAATTGG + Exonic
1062988362 10:1790984-1791006 CTGCACCCAGAACCCAGCACTGG - Intergenic
1069713858 10:70508359-70508381 CTCCTCACAGTCCCTAGAATGGG - Intronic
1070530655 10:77334214-77334236 CTACTCCCACCACCTAGAACTGG + Intronic
1070959656 10:80489674-80489696 CACCTCCCAGAACCTAAAACAGG - Intronic
1071297673 10:84234030-84234052 CTGCACTGAGAACCTAGACTGGG - Intronic
1071297879 10:84235595-84235617 GTATTCCCAGCACCTAGAATTGG + Intronic
1072005651 10:91244307-91244329 CTGCTCCCTTTACCTGGAATAGG - Intronic
1072565114 10:96610746-96610768 CTGCTCCTAGAACCCAGCATTGG - Intronic
1075198144 10:120378878-120378900 CTGCTACCGAAACCTTGAATGGG - Intergenic
1075787048 10:125057065-125057087 CTGCCCCCAGGACCTGGCATGGG - Intronic
1078293592 11:10042202-10042224 CTGTTCCTAGTACCCAGAATTGG + Intronic
1079452337 11:20607744-20607766 GTGTTCCCAGAACCTAGTATAGG - Intronic
1080228404 11:29987053-29987075 CTGCCCCTAGAAGCTAGAAAAGG + Intergenic
1083629211 11:64087189-64087211 CTTCTGCCAGATCCAAGAATCGG - Intronic
1084455037 11:69263537-69263559 CTGCTTTCAGAACCTAGAGTGGG - Intergenic
1084536179 11:69758564-69758586 TTGTTCCCAGCCCCTAGAATTGG - Intergenic
1085164084 11:74380277-74380299 CTGCTCCAAGACTCTAGACTTGG - Intronic
1085285524 11:75357562-75357584 CTGCCCCCAGAAACTAGATATGG + Intergenic
1086969251 11:93063079-93063101 GTGCTCCCAGAATGTAGTATGGG - Intergenic
1088118986 11:106345628-106345650 TTAATCCCAGAACCTAGCATAGG - Intergenic
1088450170 11:109973220-109973242 CTCCACCCACCACCTAGAATAGG + Intergenic
1088532632 11:110827417-110827439 CAGCTCCCAGAAGCTGGAAGAGG + Intergenic
1089031195 11:115331092-115331114 TTCCTTCCAGAAACTAGAATGGG + Intronic
1089898339 11:121955119-121955141 GGGCTACCAGAACCTAGGATAGG + Intergenic
1090644304 11:128755258-128755280 CTTCTCCCCCAACCTAGAAGAGG + Intronic
1091592663 12:1854107-1854129 CTTCTCCCTGAACTTAGGATGGG - Intronic
1091988349 12:4932756-4932778 CCGCTGCCAGAAGCTAGAAGAGG - Intergenic
1092133409 12:6128468-6128490 CTGCTCCCTGACCCAAGAGTGGG - Intergenic
1093064012 12:14637663-14637685 CGGCTCCAAGAACATACAATGGG + Intronic
1097447624 12:59692094-59692116 CTGCCACCAGAAGCTAGAAGAGG - Intronic
1100279235 12:93102284-93102306 ATGATCCCAGAACTTAGAAAGGG + Intergenic
1100467235 12:94857070-94857092 GTGTCCCCAGAACCTAGCATTGG - Intergenic
1102711692 12:114933535-114933557 CTGTTCTCAGAATTTAGAATTGG - Intergenic
1103087627 12:118073768-118073790 CTGCTCCCAGGACCTGGATGAGG - Exonic
1104155064 12:126123275-126123297 CTTCTCCAAGAATCTAGAACAGG + Intergenic
1104561357 12:129847976-129847998 CGGCTCCAAGAACCTGAAATGGG + Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1107384976 13:39898281-39898303 CTGCCTCCAGAAGCTAGAAAAGG + Intergenic
1108210327 13:48132854-48132876 CTCCTCCCAGAGCCTCGAAAAGG - Intergenic
1109063246 13:57648376-57648398 CTGCTCCCAGGAAATATAATTGG + Intronic
1110442690 13:75542883-75542905 CTGCTTCTAGAAGCTAGAATGGG + Intronic
1110868952 13:80428343-80428365 CTGCTTCCAGAACAAAGAGTGGG - Intergenic
1111958378 13:94782701-94782723 CTGCTTCCAGGAACAAGAATAGG - Intergenic
1115648177 14:35384534-35384556 CTGCTCCCAGACACAAGCATGGG + Intergenic
1116294180 14:43084657-43084679 CGGCCACCAGAAGCTAGAATAGG - Intergenic
1117757092 14:58986695-58986717 CAGCCACCAGAACCTAGAAGAGG - Intergenic
1119674283 14:76542255-76542277 CTGCACCCAGAACCTGGTAAGGG - Intergenic
1121044396 14:90777435-90777457 CAGCTCCCAGAACCTCCTATGGG - Intronic
1121047939 14:90801702-90801724 CTGCTACCAAAACCAAGATTAGG + Intronic
1121268854 14:92624336-92624358 CTGCTCCCATACCATAGAAACGG + Intronic
1121754065 14:96388604-96388626 CTGCTCCCAGATCCTTGAAGAGG + Intergenic
1124158982 15:27252324-27252346 CTGCTCCCAGACCCCAGGCTGGG + Intronic
1124195349 15:27621179-27621201 CTGTTCCCAGCACATAGAAATGG + Intergenic
1129085034 15:73080432-73080454 CCTCTCCCAGATCCTAGAAGAGG - Intronic
1129459203 15:75691741-75691763 GTGCTCCCAGATGGTAGAATGGG + Intronic
1130227291 15:82068956-82068978 CTGATCCCAGATCCCAGATTTGG + Intergenic
1130272733 15:82460669-82460691 GTGCTCCCAGATGCTAGAATAGG - Intergenic
1130465085 15:84188023-84188045 GTGCTCCCAGATGCTAGAATAGG - Intergenic
1130487603 15:84406781-84406803 GTGCTCCCAGATGCTAGAATAGG + Intergenic
1130499180 15:84485514-84485536 GTGCTCCCAGATGCTAGAATAGG + Intergenic
1130584459 15:85169856-85169878 ATGCTCCCAGAACAAAGAAATGG + Intergenic
1130587375 15:85192636-85192658 GTGCTCCCAGATGCTAGAATAGG - Intergenic
1130883985 15:88078218-88078240 CTACCCCCAGAACATACAATAGG - Intronic
1136530552 16:30865613-30865635 CTACTGCCAGTACCTTGAATTGG - Intronic
1138111200 16:54325397-54325419 CTGCTCCCTGACCCCAGAAGTGG + Intergenic
1138633458 16:58317799-58317821 CTTCTGCCAAAACATAGAATGGG + Intronic
1140378913 16:74468906-74468928 CTGCTCCCAGAAACCACAGTGGG - Intronic
1142326171 16:89416222-89416244 CTGCTGACAGGACCTGGAATTGG - Intronic
1144225490 17:13140951-13140973 CTGCTCCCACTAACAAGAATAGG + Intergenic
1144659207 17:17057489-17057511 CAGCTCCCAGCACCTAGCACTGG - Intronic
1145867578 17:28250756-28250778 CTGCTCCCAGAGCCCAGCTTGGG + Intergenic
1146678431 17:34789974-34789996 CTGAACACAGAACCGAGAATTGG + Intergenic
1147563492 17:41522710-41522732 CTGGGCCCAGAGCCCAGAATGGG - Intergenic
1151307366 17:73271899-73271921 CAACTGCCAGAATCTAGAATTGG + Intergenic
1153095375 18:1395284-1395306 CAGATGCCAGCACCTAGAATAGG + Intergenic
1153288892 18:3481177-3481199 CTGCACACAGCACCTAGCATGGG - Intergenic
1156330615 18:36118248-36118270 CTGCTCCCAGCATTTAGCATAGG - Intronic
1157699951 18:49755989-49756011 CTGCTCCCAGTGCCTAGCACAGG + Intergenic
1159230362 18:65599855-65599877 TTATTCCCAGAACCTAGCATAGG - Intergenic
1159875107 18:73802062-73802084 CTGTGCCCAGAACCTAGGTTTGG - Intergenic
1166667077 19:44686924-44686946 GTCTCCCCAGAACCTAGAATAGG - Intergenic
1166892341 19:46001070-46001092 CGGCTCCCAGAACCTATCAGCGG - Intronic
1167461220 19:49625635-49625657 CTCCTCCATGAACCGAGAATTGG + Exonic
1167701900 19:51053527-51053549 CTGCCCTCAGATCCTGGAATAGG + Intergenic
1168310310 19:55456634-55456656 CTGTTCCCCGGGCCTAGAATGGG + Intronic
927464727 2:23328651-23328673 CTGCTCCCAGAAGACAGAGTGGG - Intergenic
929962925 2:46509915-46509937 TGTCTCACAGAACCTAGAATAGG - Intronic
935381113 2:102452021-102452043 TTTGGCCCAGAACCTAGAATTGG - Exonic
935751633 2:106240185-106240207 TTGTTCCCAGAACCTAGGAAGGG + Intergenic
935912052 2:107907733-107907755 TTGTTCCCAGAACCTAGGAAGGG + Intergenic
936529007 2:113262128-113262150 CTGATACAAGAACCTAAAATCGG - Intronic
936562889 2:113557167-113557189 CTGCTGCCAGAAGCTGGAAGAGG - Intergenic
937083445 2:119156462-119156484 CTCCTCCCAGTGCCTAGAAGCGG - Exonic
937304079 2:120860493-120860515 CTGCTCCCAGAATCTCGAAAGGG - Intronic
937469993 2:122166481-122166503 GTATTCCCAGAACCTAGAACAGG + Intergenic
938301402 2:130216564-130216586 TTGGTCCCAGAACCCAGAAATGG - Intergenic
938455308 2:131457909-131457931 TTGGTCCCAGAACCCAGAAATGG + Intergenic
938710668 2:133973802-133973824 TTGCTCTCAGAATCTAGAAAAGG - Intergenic
939003654 2:136762912-136762934 CTGCTCTCAAAATCTAGATTAGG - Intergenic
939043635 2:137223163-137223185 CTGCTCCAGGAAACTAGAACTGG + Intronic
939389310 2:141545819-141545841 CAGCTTCCAAAAGCTAGAATAGG + Intronic
939533100 2:143390322-143390344 CTGCTGCCTGATCCTAGAAAAGG + Intronic
939646907 2:144711305-144711327 CTGATCACAGAACCAAGAATGGG + Intergenic
939816077 2:146898852-146898874 TTGCTTCCAGAAAATAGAATTGG - Intergenic
942134499 2:172911412-172911434 CAACTCCCGGAAACTAGAATTGG - Intronic
944484847 2:200194806-200194828 CTACCCCCAGTACCTAGCATAGG - Intergenic
945682958 2:212935735-212935757 GTGTTCCCAGAAGCTAGAAAAGG + Intergenic
947613373 2:231537890-231537912 CTGCTCCCAGACCCTCCAGTGGG + Intergenic
1168925400 20:1574973-1574995 ATCCTCACAGAACCCAGAATAGG + Intronic
1168929278 20:1608001-1608023 ATCCTCACAGAACCCAGAATAGG + Intronic
1168933786 20:1645848-1645870 ATCCTCACAGAACCTAGAGTAGG + Intronic
1170713657 20:18813875-18813897 CTGAACCCAGAACCTCGAACTGG - Exonic
1172771090 20:37383056-37383078 GTGCTCCCAGTGCCTAGCATGGG - Intronic
1173391370 20:42637469-42637491 TTGCTCCCTCAACCCAGAATGGG + Intronic
1174385679 20:50187447-50187469 CTGCCCTCAGAACCTAGAGCCGG - Intergenic
1179257797 21:39731920-39731942 TTGCAGCCCGAACCTAGAATTGG - Intergenic
1180988900 22:19921858-19921880 CTGTTCCCAGAATCTGGACTGGG + Intronic
1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG + Intergenic
1183263177 22:36809317-36809339 CTAATCCCAGCACCTAGAATAGG - Intronic
1184032496 22:41903205-41903227 CTGAGCCCAGAACCCAGCATGGG + Intronic
1184304517 22:43587497-43587519 CTGCTCCCAGAAGCTGAAAGAGG - Intronic
1185012294 22:48321002-48321024 CTGCTCCCCAAACCCAGACTCGG + Intergenic
1185077700 22:48692060-48692082 CTCCTCCCTGAACCTGGGATGGG + Intronic
949698596 3:6728987-6729009 CTAGTCCAAGAACTTAGAATAGG + Intergenic
951201316 3:19877768-19877790 CTGCTCTCAGAGCTAAGAATTGG + Intergenic
952664238 3:35885220-35885242 TTGTTCCCAGAGCCTAAAATGGG + Intergenic
953066754 3:39480287-39480309 CTGCTCCCAGAACCTAGAATAGG - Intronic
953319799 3:41961770-41961792 CTGCACCCAGGTCCTAGAAGAGG + Intronic
954595472 3:51820348-51820370 GGGTTCCCAGGACCTAGAATGGG + Intronic
954613943 3:51960054-51960076 CTGCTCCCATAACCCAGAAAAGG + Intronic
954676245 3:52317275-52317297 CTGCTCTCAGCACCTGGCATGGG - Intronic
955141332 3:56272868-56272890 CTGTTCCCATAACGTAGCATTGG - Intronic
956388312 3:68744628-68744650 CTGATGCCAAAACCTAGAAAAGG + Intronic
956799140 3:72740986-72741008 CTGCTCCCGGAAATTTGAATTGG - Intergenic
956942384 3:74178692-74178714 CTCCTCCCAGAACCTTGCAAGGG + Intergenic
957475706 3:80721171-80721193 TGGCTCCCAGAATCTTGAATCGG - Intergenic
959637896 3:108595904-108595926 GTATTCCCAGAACCTAGAAATGG - Intronic
961518942 3:127455930-127455952 CTGCTCCCAGGCCCTAGAGAGGG - Intergenic
961584880 3:127914239-127914261 ATGCTTCCACAACCTAGAAATGG - Intergenic
961601519 3:128066079-128066101 GAGCTCCCAGTACCTAGAACAGG - Intronic
962314394 3:134350264-134350286 CTCCCCCCAGTATCTAGAATGGG + Intergenic
963600351 3:147373034-147373056 CTGCTCCCAGACCTGAGAAAAGG + Intergenic
963986886 3:151606567-151606589 CTGCTCCCAAAACTTTGAAATGG + Intergenic
964167153 3:153722301-153722323 CTGCTGCCATAATCTTGAATTGG - Intergenic
969433373 4:7169115-7169137 CTGTTCCCAGAACCTATGATGGG + Intergenic
971243604 4:24910124-24910146 CAGCTCCCAGAAGCTGGAAGAGG - Intronic
976072382 4:81256506-81256528 CTGCGTTCAGAAACTAGAATTGG - Intergenic
976402017 4:84618155-84618177 TTGCTCTCAGAACCTTGACTAGG + Intronic
978008695 4:103651886-103651908 CTGCACCTAGAACCTGGAAAGGG + Intronic
981210517 4:142098512-142098534 CTGTTGCCAAAACCTAGAAGAGG + Intronic
983378608 4:166961895-166961917 ATGCTCACAGAAACTGGAATAGG - Intronic
984233870 4:177132969-177132991 CTGCTCCCAGAAGGTTAAATTGG - Intergenic
984474128 4:180215597-180215619 CTGCACCAAGAACCCACAATGGG - Intergenic
986779139 5:11048135-11048157 GAGCTCCCAGAACCTGGAACTGG + Intronic
987371127 5:17193969-17193991 CAGCTACCAGAAGCTAGAAGAGG + Intronic
988319164 5:29670122-29670144 CAGCCTCCAGATCCTAGAATGGG + Intergenic
988691713 5:33579073-33579095 CTTCTCCCTGGACCTAGAAAGGG + Intronic
989332968 5:40281388-40281410 CTGATCCCAGGGCCTAGGATAGG + Intergenic
991584995 5:68193024-68193046 GTGCTTCCAGAACCTAGCACAGG + Intronic
992525105 5:77601944-77601966 ATGTTCCCAGAACATAGAAATGG - Intronic
993199042 5:84788941-84788963 CAGCCGCCAGAACCTAGAAGAGG - Intergenic
993515259 5:88825159-88825181 CTGTTCCAAGAACTTTGAATTGG - Intronic
993866518 5:93203050-93203072 CTGCTTCCAGAACCGCGATTTGG - Intergenic
995335787 5:110997985-110998007 CTGCTACCAGAAGCTAGGAGAGG + Intergenic
995541810 5:113193051-113193073 CAGCTACCAGAAGCTAGAATAGG - Intronic
995687381 5:114785254-114785276 CGGCTGCCAGAAGCTAGATTGGG + Intergenic
997595576 5:135105102-135105124 CTGTTCCAAGAACCAAGACTGGG - Intronic
998006184 5:138658577-138658599 TTGCTCCCAGAACACTGAATGGG - Intronic
1001674167 5:173498858-173498880 CTGTCCCCACAACCCAGAATTGG + Intergenic
1001789469 5:174443566-174443588 CCTCTCCCACAACCTAGAACAGG + Intergenic
1001804299 5:174570378-174570400 CTATTCCCAGCATCTAGAATGGG + Intergenic
1002160028 5:177309611-177309633 CAGCCCCCAGTGCCTAGAATAGG + Intronic
1003056685 6:2827120-2827142 CTGCTCTCACACCTTAGAATTGG + Intergenic
1005920525 6:30397137-30397159 CTGCTCCCAGCACCTGGACAGGG + Intergenic
1007320323 6:41023879-41023901 CTGCTGCCAGAACCTTGATATGG + Intergenic
1012328902 6:97959745-97959767 CTATTCCCAGTGCCTAGAATGGG - Intergenic
1012964850 6:105662498-105662520 CTTCTCCCATGACCCAGAATAGG - Intergenic
1013880467 6:114893270-114893292 CTTCACCCAGACCCAAGAATTGG + Intergenic
1013899122 6:115131936-115131958 CTGCTCCCAACACCAAGGATGGG - Intergenic
1014451987 6:121592446-121592468 CAGCTTCCAGAAGCTAGAAAAGG + Intergenic
1015124418 6:129736971-129736993 CAGCTTCCAGAAGCTAGAAAGGG + Intergenic
1018769265 6:166957159-166957181 GTGCTCCCAGCACCTAGCACCGG - Intronic
1021277818 7:18676376-18676398 ATGCTCAAAGAACTTAGAATGGG + Intronic
1025965120 7:66262496-66262518 CTCCTCCCAGAACCCCAAATGGG + Intronic
1026333084 7:69370164-69370186 TTGCTCTCAGCACCTAGGATGGG - Intergenic
1028956792 7:96702290-96702312 CTGCTCCCAGACCCTCTAAGTGG - Intronic
1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG + Intergenic
1029996869 7:105014709-105014731 CTTCTCCCTGACCCTAGAAATGG + Intronic
1032306814 7:130741766-130741788 CTGCTTCTAGAAGCTAGAAAAGG - Intergenic
1033612682 7:142980720-142980742 CTGATACCAAAACCTAGAAGAGG - Intergenic
1034459642 7:151191375-151191397 CTGCTACCAGAACCCACAAAGGG + Intronic
1034920041 7:155072017-155072039 CAGCTTCCAGCACTTAGAATGGG + Intronic
1035102558 7:156413631-156413653 GTGTTCCCAGTACATAGAATAGG + Intergenic
1035287391 7:157815054-157815076 CTGCTCCCAGAATAAAGACTAGG - Intronic
1036175733 8:6536555-6536577 ATGCTCCCAGAAGATAGAATTGG - Intronic
1039141638 8:34396321-34396343 CTGGTGCCAGAATCTATAATGGG - Intergenic
1041910923 8:63087306-63087328 GTGCCCTCAGTACCTAGAATAGG - Intergenic
1042389169 8:68213358-68213380 CCCCTCCCAGAACCTGGAAAGGG + Intronic
1044480521 8:92682086-92682108 CTTCTCCCAGAACAGAGGATGGG - Intergenic
1045242410 8:100414206-100414228 CTGTTTCCATAAACTAGAATGGG - Intergenic
1047239486 8:123073018-123073040 CCGCTCCCAGAACTCAGAAGGGG - Intronic
1047256844 8:123220285-123220307 CTTCTCCCATAACCTATAACAGG + Exonic
1049621540 8:143600437-143600459 CTGCACCCAGAACCTAATACAGG - Exonic
1049889845 9:58532-58554 CTGCTGCCAGAAGCTGGAAGAGG + Intergenic
1052714049 9:32093355-32093377 CTGCTCCCGTTACCTAGAATTGG - Intergenic
1053731324 9:41059807-41059829 CTGCTGCCAGAAGCTGGAAGAGG + Intergenic
1054697184 9:68372282-68372304 CTGCTGCCAGAAGCTGGAAGAGG - Intronic
1060980641 9:127789655-127789677 CTGCTCCCAGAGCCCAGGGTGGG - Exonic
1061088279 9:128411948-128411970 CTGCACCCAGAACCAGGAGTGGG + Intronic
1062434831 9:136542299-136542321 CTTCTCCCAGAGCCCCGAATGGG + Intronic
1186448944 X:9656048-9656070 CTGTTGCCAGAACATAGTATAGG + Intronic
1186466973 X:9790913-9790935 CAGCTCCCAGACCCTGGAATAGG - Intronic
1189009484 X:37032127-37032149 CAGTTTCCAGAACCTAGTATTGG - Intergenic
1190483625 X:50902078-50902100 CTGCTCCCAGCACTTAGAAATGG - Intergenic
1195169643 X:102253731-102253753 CTGCTACCAAAACCAAAAATGGG - Intergenic
1195189214 X:102433368-102433390 CTGCTACCAAAACCAAAAATGGG + Intronic
1195557555 X:106244160-106244182 CTGCCCCCAGAACCAAGACTGGG - Intergenic
1202370152 Y:24190670-24190692 GTGCTCCCAGGTGCTAGAATAGG + Intergenic
1202500632 Y:25479447-25479469 GTGCTCCCAGGTGCTAGAATAGG - Intergenic