ID: 953069971

View in Genome Browser
Species Human (GRCh38)
Location 3:39509841-39509863
Sequence GTTCCCCAGGGACCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953069967_953069971 24 Left 953069967 3:39509794-39509816 CCTCTCTGATGAGATACAGATGA 0: 1
1: 0
2: 0
3: 9
4: 166
Right 953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG 0: 1
1: 0
2: 2
3: 37
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953069971 Original CRISPR GTTCCCCAGGGACCCCCAGC AGG Intronic
900524398 1:3121474-3121496 GTAGCCCAGAGGCCCCCAGCTGG + Intronic
900543995 1:3218392-3218414 CTTCCCCAGGTATCCCCAGGGGG + Intronic
900683076 1:3928520-3928542 GTACCCCAGTGACTCGCAGCTGG - Intergenic
901018813 1:6245787-6245809 CTTTCCCAGGGACCCCTGGCGGG + Intergenic
901065589 1:6492723-6492745 CTTCCCCAGGGTCGCACAGCTGG + Intronic
901165823 1:7220925-7220947 GCTCCCTAGGGCCCTCCAGCTGG + Intronic
901691460 1:10976062-10976084 GTTGCCCAGTGTCACCCAGCAGG + Intronic
901740642 1:11339575-11339597 GTTCCCCACCCAGCCCCAGCTGG - Intergenic
902983528 1:20141913-20141935 GAGCCCCAGGGAGTCCCAGCTGG + Intronic
904462653 1:30689393-30689415 ATACCCCAGGGACTCCCAGCTGG + Intergenic
906075243 1:43047188-43047210 TTTCTCCAGGGACCTCCACCTGG - Intergenic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
907938693 1:59066217-59066239 GCTCCCCAGGGCCCCAGAGCTGG + Intergenic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
910034904 1:82777821-82777843 CTTCCCCATGTTCCCCCAGCTGG - Intergenic
912950733 1:114118599-114118621 GAGCCCCAGGGACACCCCGCCGG - Intronic
913376455 1:118157709-118157731 CTTGCCCAGGGACACACAGCTGG - Intronic
915009775 1:152675016-152675038 GTACCCAAGGGACCCACACCTGG - Intergenic
915931483 1:160063137-160063159 CCTGCCCAGGGAACCCCAGCAGG + Intronic
919884478 1:201923145-201923167 CTTCCCCAGGGTCTCCCAGAGGG + Intronic
920513684 1:206568603-206568625 GTCCTCCAGGGAGCTCCAGCTGG + Intronic
922570690 1:226633221-226633243 GTTCCCCAGAGACCCCGGGGTGG + Exonic
923114077 1:230917946-230917968 TTTCCCCAGCGCCCCCCAGGGGG - Intronic
923855036 1:237837446-237837468 GTTCAGCAGGGACCTCCAGTCGG + Intergenic
1063611736 10:7568625-7568647 GTTGCACAGGGTCCCCCAGCAGG - Intronic
1064038573 10:11937105-11937127 TTTCTCCAGGGCTCCCCAGCAGG + Intronic
1065487549 10:26249572-26249594 GTTCTCCAGTGAACCCCAGGGGG + Intronic
1069618957 10:69824553-69824575 GTTCCACACAGACTCCCAGCAGG - Intronic
1069854802 10:71434213-71434235 CCTCCCCAGTGACCCTCAGCTGG + Intronic
1070751364 10:78965785-78965807 TTTGCCCAGGGTCCCACAGCAGG - Intergenic
1071466123 10:85941170-85941192 CTTACCCAAGGACACCCAGCTGG - Intronic
1071602150 10:86963537-86963559 GTTCCTCAGGGACTCAGAGCAGG - Intronic
1071858001 10:89645147-89645169 GATCCCCGCGCACCCCCAGCCGG + Exonic
1072232995 10:93428923-93428945 GTGCTCCAGGGACCCCCAAAAGG + Intronic
1072537835 10:96376816-96376838 GTCCCCCTGCCACCCCCAGCTGG - Exonic
1072628392 10:97129045-97129067 TTTCCCCAGGGACACAGAGCAGG - Intronic
1073120854 10:101121920-101121942 ATTCGCCAGGGACCACCATCTGG - Intronic
1073208583 10:101781268-101781290 TTTCCCTAGGGACCGCCAGGTGG - Intergenic
1074047669 10:109853373-109853395 CTTGCCCAGGGACTCACAGCTGG + Intergenic
1074597566 10:114881489-114881511 GTTGCCCAGGATTCCCCAGCTGG + Intronic
1074845175 10:117391471-117391493 CTTGCCCAGGGTCCCCCAGCAGG + Intergenic
1074951688 10:118342890-118342912 GTTCCCCAAGCACCCCCTTCTGG - Intergenic
1075522063 10:123148847-123148869 CTTCCCCAGGAAGCCCAAGCCGG - Intronic
1075857057 10:125638466-125638488 ATTCCCCCTGGACCCCCAGAAGG + Intronic
1076000039 10:126906366-126906388 GCGCCCCGGGGACCCGCAGCCGG + Intronic
1076533367 10:131160196-131160218 ATTCTCCAGGGAGCCCCAGGTGG - Intronic
1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG + Intronic
1077049144 11:558940-558962 GGTCACCTGGGACCTCCAGCAGG - Exonic
1077073907 11:691225-691247 GTTGGGCAGGGACTCCCAGCAGG - Intronic
1077284960 11:1761541-1761563 ATTCCCCAGGGGCCTCCAGGTGG - Intronic
1077334730 11:1998199-1998221 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1078084582 11:8225959-8225981 GGTCCCCAGGGACTCCCACAGGG + Intronic
1078735503 11:14016133-14016155 GTTCCTGAGGCACCACCAGCAGG - Intronic
1079024076 11:16932103-16932125 ATTATCCAGGGTCCCCCAGCTGG - Intronic
1080135121 11:28844952-28844974 GTTTCCCAGAGACCCAGAGCTGG + Intergenic
1081667704 11:44926258-44926280 GATCCCCAGGGACCACCTGTTGG + Intronic
1081831500 11:46119950-46119972 GCGCCCCCGGGACCCCGAGCGGG - Intronic
1081877063 11:46415810-46415832 GTTCCCCAGGCAGCCCAAGATGG + Intronic
1082244130 11:49901481-49901503 GTCACCCAGGGACCCACAGGAGG - Intergenic
1082566133 11:54680565-54680587 GTCACCCAGGGACCCACAGGAGG + Intergenic
1082618056 11:55386441-55386463 TCTCCCCAGGGACCCACAGGAGG + Intergenic
1082622404 11:55440086-55440108 TCTCCCCAGGGACCCACAGGAGG + Intergenic
1084029705 11:66474021-66474043 CTGCCCCAGGGAGCCCCAACAGG + Intronic
1084399772 11:68936851-68936873 GCAGCCCTGGGACCCCCAGCAGG + Exonic
1084447090 11:69209884-69209906 GTTTCCCAGGGTCACGCAGCTGG - Intergenic
1084603006 11:70157525-70157547 GTTCCAAAGTGACCCCCAGTGGG + Intronic
1084954817 11:72685555-72685577 GTTTCCCATGCACCCCCCGCTGG + Exonic
1087195393 11:95299700-95299722 GTTCCCCGGAGACAACCAGCTGG - Intergenic
1088920730 11:114258230-114258252 GTTCTCCAGGGACCTTAAGCGGG + Intronic
1089166644 11:116482591-116482613 GGTCTCCAGGGTCCCCCAGTTGG - Intergenic
1089384459 11:118058763-118058785 CTTCCCCAGGCCCCCCGAGCTGG - Intergenic
1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG + Intergenic
1089668308 11:120034222-120034244 GTTGGCCAGGGAACCCCAGGCGG + Intergenic
1089711376 11:120317241-120317263 GTTCCCCTGGGAACAACAGCAGG + Exonic
1091311331 11:134577131-134577153 CTTCCCCAGGCCCACCCAGCAGG - Intergenic
1202817713 11_KI270721v1_random:53381-53403 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1091402810 12:190927-190949 GAGCCACAGGCACCCCCAGCTGG - Exonic
1091644208 12:2261550-2261572 GTGTCCCAAGGAACCCCAGCAGG - Intronic
1092019610 12:5190311-5190333 GTAGTCCAAGGACCCCCAGCTGG + Intergenic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1098607112 12:72404399-72404421 GTTCCCCAGGCTGCCCAAGCTGG - Intronic
1098841900 12:75487487-75487509 TATCCCCAGGAACCCCCTGCGGG - Intronic
1101876499 12:108599715-108599737 CTCCCCCAGGGCCCACCAGCAGG + Intergenic
1101957349 12:109222961-109222983 TTTCCCCAGAGGCCCCCACCTGG - Intronic
1102045689 12:109828781-109828803 TTTACCCAGGGATGCCCAGCTGG - Intronic
1102245525 12:111353363-111353385 GTTGCCCAATGGCCCCCAGCTGG - Intergenic
1102435614 12:112920897-112920919 CTTGCCCAGGGTCACCCAGCTGG + Intronic
1102624415 12:114223324-114223346 GTACCCCAGGGAGTCCCAGGTGG + Intergenic
1102682963 12:114702948-114702970 GGTTTCCAGGGGCCCCCAGCAGG + Intergenic
1103415463 12:120739533-120739555 GGTCCCCAGGGAGCCCCCGCCGG - Exonic
1103484485 12:121273764-121273786 GTTCCCCAGGGTCCCACGGAAGG + Intronic
1103577483 12:121889031-121889053 GTACCCCAGGGACTCCGGGCCGG - Intronic
1103721544 12:122978144-122978166 GTAGCCCAGGGACACCCAGCAGG - Intronic
1104201080 12:126589810-126589832 CTTACCCAGGGCCTCCCAGCTGG - Intergenic
1104667253 12:130656302-130656324 GATCTCCAGGGACCCCTGGCAGG + Intronic
1105296270 13:19090072-19090094 GTATCCCAGGGACCCTCTGCAGG - Intergenic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1114083531 14:19220640-19220662 GCTCCCGTGGGACCCTCAGCAGG + Intergenic
1117063338 14:51984539-51984561 GTACCTCAGTGACCCCCACCAGG - Intergenic
1118224624 14:63887452-63887474 CTTCCCCAGGGACCCACAGAGGG - Intronic
1118652092 14:67907568-67907590 GTTCCAGCTGGACCCCCAGCAGG - Intronic
1119110637 14:71970762-71970784 GTTCCCCATTTACCCCCAGCTGG - Intronic
1119952842 14:78763764-78763786 GTTTCCCTGGGACACACAGCTGG + Intronic
1121038865 14:90728737-90728759 GTACCCCTGGGACCTCCAGGGGG + Intronic
1121517411 14:94561738-94561760 CTCCCCCAGGGACACACAGCTGG + Intronic
1121558127 14:94854004-94854026 GATGCCCAGGTAACCCCAGCTGG + Intergenic
1122071427 14:99207908-99207930 CTTGCCCAGGGCCACCCAGCTGG - Intronic
1122297326 14:100712833-100712855 GGTCCCCAGGGCCACCCAGCAGG + Intergenic
1122413742 14:101538813-101538835 ATCCCCCAGGGAAGCCCAGCTGG + Intergenic
1122771658 14:104100408-104100430 TTGCCCCAGGGCCCCTCAGCAGG + Intronic
1122784627 14:104157992-104158014 GGTCCCCAGGGGCCCACAGCCGG - Intronic
1123149856 14:106170473-106170495 GTTTGCCTGGGACCACCAGCAGG - Intergenic
1125734364 15:41913319-41913341 CTTCCCCAGGGACAACCACCAGG - Intronic
1126877505 15:53060118-53060140 CTTGCCCAGGGTCACCCAGCTGG - Intergenic
1127377572 15:58398996-58399018 GTGCCTCAGGGTCCCCCAGAGGG - Intronic
1127605145 15:60579298-60579320 GTGATCCAGGGACCCCCTGCGGG - Intronic
1128232741 15:66046932-66046954 GGTCCCCAGGTTCCCCCTGCAGG + Intronic
1129152100 15:73695836-73695858 GTTGCCCAAGGAGCCCCTGCGGG + Intronic
1129676879 15:77636535-77636557 GCTCCACAGGGCCCCCCAGCTGG - Intronic
1129761775 15:78132994-78133016 CTTGCCCAGGGTCCCACAGCTGG + Intronic
1132547509 16:540176-540198 GCTCCCCATGGCCCCCCGGCCGG - Intronic
1132576911 16:668448-668470 GCTCACCAGGGACCCCCGGCTGG - Intronic
1132657740 16:1048412-1048434 GCTCCCCAGGGACCCCCACTAGG - Intergenic
1132692979 16:1189895-1189917 GTTCCCCAGGCAGCCCCCACTGG - Intronic
1133242240 16:4421823-4421845 GTTGCCCAAGGACACACAGCTGG + Intronic
1133268714 16:4600209-4600231 ATCCCTAAGGGACCCCCAGCAGG + Exonic
1133428080 16:5710752-5710774 GGTCCCCAGGGACACAGAGCCGG - Intergenic
1135849912 16:25953810-25953832 GTTCACCAGAGTTCCCCAGCAGG - Intronic
1136515657 16:30766644-30766666 ATTCCCCAGGGACCCCTGGCTGG - Intronic
1137001740 16:35235237-35235259 GTGCCCCAGGGAACCCCAGGTGG + Intergenic
1137023435 16:35452142-35452164 GTTCCCCAGGTGTCCCCAGAGGG + Intergenic
1138539994 16:57682289-57682311 CACCCCCAGGGACCCCCAGGAGG - Intronic
1139952997 16:70680936-70680958 GTGGCCCAGGGCACCCCAGCAGG - Intronic
1140880769 16:79196356-79196378 GTCCTCCAGGTACCCCAAGCTGG + Intronic
1141086231 16:81097212-81097234 GAGCCCCAGGGACCCCAAACAGG + Intergenic
1141649494 16:85385495-85385517 GCTCCCCAGGGCCCCCGAGAAGG - Intergenic
1141769432 16:86080398-86080420 GTTCCCCAGAGCCCCCCAAGAGG + Intergenic
1141865759 16:86748764-86748786 GTAATCCAGGGCCCCCCAGCGGG - Intergenic
1142254281 16:89006499-89006521 GTTCCCCAGAGACCCCCACCTGG - Intergenic
1142765989 17:2064661-2064683 GTGCCCCAGGGACCCCTGGGGGG + Intronic
1142769430 17:2085972-2085994 GTTCCCCTGTGCCCCTCAGCCGG - Intronic
1143121060 17:4607227-4607249 GTTCCCAAGGACCCACCAGCGGG - Intronic
1143582706 17:7835952-7835974 GTTCCCCACCTCCCCCCAGCTGG + Intergenic
1143658941 17:8313019-8313041 GGTCCCCAGGGTCCCCCGTCGGG + Exonic
1144516387 17:15920007-15920029 GTACCCCAGTGGCCCCCAGGGGG + Intergenic
1145250426 17:21294158-21294180 ATTCCCCAGGGTCCCTCAGAGGG - Intronic
1145271724 17:21408395-21408417 CTTCCCCAGGGCCCCACAGGAGG - Intronic
1145817907 17:27808798-27808820 GTTCCCCAGGGGCTCCCGGGAGG + Intronic
1146164152 17:30575006-30575028 GGTCCCCAGGCCGCCCCAGCAGG + Intergenic
1147686203 17:42288264-42288286 GGTCCCCCGGGAGTCCCAGCAGG - Exonic
1148090188 17:45018811-45018833 CTTCCCCAAGGTCACCCAGCGGG + Intergenic
1148850449 17:50551977-50551999 GTCCTCCAGGAAGCCCCAGCAGG - Exonic
1149550130 17:57533740-57533762 GTTCTTCAGGGGTCCCCAGCTGG + Intronic
1150666895 17:67148232-67148254 GTTCCGCAGGGGACACCAGCTGG - Intronic
1151553780 17:74836528-74836550 CTGCCGCAGGGACACCCAGCTGG + Exonic
1151662646 17:75526678-75526700 GGGCTCCAGGGACCCCCTGCTGG + Intronic
1151745643 17:76010300-76010322 GTTCTACCGGGACCCCCAGCTGG - Exonic
1152335906 17:79700202-79700224 CCTGCCCAGGGCCCCCCAGCAGG + Intergenic
1152571875 17:81124517-81124539 GTGCCCCAGGGACCCCATGGTGG - Intronic
1153671323 18:7415169-7415191 GTTACCCAAGGGCCCCCAGGGGG + Intergenic
1158267582 18:55677262-55677284 TGTCCCCAGGGACCCAGAGCAGG - Intergenic
1160142243 18:76336111-76336133 GTTCACCAGGTAACCCCAGATGG + Intergenic
1160190631 18:76711626-76711648 CTTGCCCAGGTACCCACAGCTGG - Intergenic
1160843869 19:1158198-1158220 GGTGCTCAGGGACCCCCAGGGGG - Intronic
1160947651 19:1651232-1651254 TTTCCCCAGGGGTCCCCAGGTGG + Intronic
1161238308 19:3208610-3208632 GTTCCCCAGGGAGGACCAACTGG - Exonic
1161884158 19:6980670-6980692 GTTCTCCAGTGGACCCCAGCTGG - Intergenic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1162463148 19:10825089-10825111 CTTCTCCATGGACCCCCAACTGG + Exonic
1163153210 19:15427014-15427036 GCCCCCCAGGGACCCTCAGATGG + Exonic
1163288850 19:16365578-16365600 GTCCCCCAGGGTGCCCCTGCCGG - Intronic
1163371443 19:16903466-16903488 GAACCCCAGGGACCCCCAGAGGG - Intronic
1164857870 19:31538964-31538986 GGTCCCTAGGGTCCCCCAGAAGG - Intergenic
1165426212 19:35746789-35746811 GTCCCCAAGGGCACCCCAGCGGG - Exonic
1165888929 19:39099093-39099115 GCTGCGCAGGGACACCCAGCAGG + Exonic
1166047759 19:40239417-40239439 GTTCCTCAGAGACTCCCACCAGG + Intronic
1166194891 19:41198946-41198968 GGTCCCCAGGGACACCTGGCTGG - Intronic
1166419085 19:42620762-42620784 GCTTCTCAGGGACTCCCAGCAGG + Intronic
1166678590 19:44754289-44754311 GTTCCAGAGGGTCCCCCAGGCGG + Intronic
1166915612 19:46194158-46194180 GCTTTCCAGGGACCCCCAGTGGG - Intergenic
1166995116 19:46716413-46716435 GTCCCCCGGGGCCCCCCGGCCGG - Exonic
925160617 2:1681119-1681141 GGTCCCCAGGCCCCTCCAGCCGG + Intronic
926048369 2:9727013-9727035 GTTCCCAAGGGAAACCGAGCTGG + Intergenic
929310821 2:40422065-40422087 CTTCCACTGGGACCCTCAGCGGG + Intronic
930651595 2:53970254-53970276 GCTACCCAGGGCCCCCCAGGTGG + Intronic
931836182 2:66100306-66100328 GCTCCCCAGGGACCCTCATGAGG - Intergenic
932708875 2:74047670-74047692 GTTCCCACGGGACCTCCAGCTGG - Exonic
936153823 2:110035743-110035765 TCTCCCCTGGGATCCCCAGCTGG - Intergenic
936190862 2:110335672-110335694 TCTCCCCTGGGATCCCCAGCTGG + Intergenic
936713868 2:115162286-115162308 GTGCCCCGGGGAACCCCGGCGGG + Intronic
937086784 2:119177201-119177223 CTTGCCCAAGGTCCCCCAGCTGG - Intergenic
937298088 2:120821825-120821847 CTTCACCAGGGCCGCCCAGCTGG + Intronic
937454211 2:122027349-122027371 CTTCCCCAAGGACACACAGCTGG - Intergenic
944070098 2:195657954-195657976 CAGCTCCAGGGACCCCCAGCAGG - Intronic
946110732 2:217413019-217413041 GTTCCTCAGTTAGCCCCAGCTGG - Intronic
946301773 2:218828338-218828360 GAGCCCCAGGGTCTCCCAGCTGG + Intronic
946363378 2:219233233-219233255 GTTAGCCAGGGAGCACCAGCTGG + Intronic
946646894 2:221846962-221846984 GCTTCCCAGGGAACCCAAGCTGG + Intergenic
948397946 2:237661428-237661450 GTTCCCCAAAGCCCTCCAGCTGG + Intronic
948428741 2:237904908-237904930 GTCCCCCAGCTACCCCCGGCTGG - Intronic
1168779753 20:478588-478610 CTTCCCCAGGTACCTCCAGATGG - Intronic
1169194389 20:3675386-3675408 GTTCCCAGGGGACCTGCAGCAGG + Intronic
1169357261 20:4917671-4917693 GGTCCCCAGGGACAGACAGCTGG - Intronic
1169373021 20:5043193-5043215 GCTCCCCAGGAATCCTCAGCTGG + Intergenic
1169914672 20:10673504-10673526 GTTCCCCACGGACGCGCGGCCGG - Exonic
1170034628 20:11977118-11977140 GCTGCCCAGGCAACCCCAGCTGG + Intergenic
1170722887 20:18899983-18900005 GTTTCCCAGAGAGTCCCAGCAGG + Intergenic
1170742766 20:19072571-19072593 CTTCCCCAGGGTCCTCCAGAAGG - Intergenic
1171209137 20:23303556-23303578 GTGCACCAGGGTCCCCCCGCGGG + Intergenic
1172039969 20:32036847-32036869 CGTCCCCAGGGCCCCCCACCTGG + Intergenic
1173058222 20:39636524-39636546 GCAAGCCAGGGACCCCCAGCTGG - Intergenic
1173247873 20:41348675-41348697 CTTCCCCTCGGACTCCCAGCTGG + Exonic
1173811934 20:45961017-45961039 TTTCCCCAGTGAACTCCAGCTGG - Intronic
1173837938 20:46138108-46138130 GTTCCCCAGTGCCACTCAGCTGG + Intergenic
1173930412 20:46813058-46813080 TTTTCCCAGGGACACACAGCAGG - Intergenic
1174703304 20:52631083-52631105 GTTGCCCAGGGTCCCACAGCTGG - Intergenic
1175159818 20:56999872-56999894 CCTCCCCAAGGACACCCAGCTGG - Intergenic
1175311796 20:58017628-58017650 CTTCCCCTGGGCCCCCCACCAGG + Intergenic
1175945424 20:62556377-62556399 GATCCCCAGGGAGCACCATCAGG - Intronic
1176121841 20:63457610-63457632 GTTCCCGAGGGAGCCACAGCTGG - Intronic
1176614842 21:9018396-9018418 GTTCCTGTGGGACCCTCAGCAGG + Intergenic
1179602535 21:42489759-42489781 ATTCCCCAAGGTCCCACAGCTGG + Intronic
1179627224 21:42655511-42655533 CTTCCCCAGGGCCCACCTGCAGG - Intronic
1180212034 21:46300654-46300676 GCTCCCCAGGGACAGCCACCTGG - Intronic
1180294444 22:10872627-10872649 GCTCCCGTGGGACCCTCAGCAGG - Intergenic
1180497250 22:15902041-15902063 GCTCCCGTGGGACCCTCAGCAGG - Intergenic
1181066905 22:20311073-20311095 GCTCCCCAGCCACCCACAGCAGG - Intergenic
1181553142 22:23652452-23652474 GTACCCAAGGGACACCCAGGGGG - Intergenic
1181858580 22:25800607-25800629 GTCTCCCAGGGGTCCCCAGCTGG - Intronic
1182072683 22:27474876-27474898 CTTCCCCAGGGACACACAGCAGG + Intergenic
1182083100 22:27543100-27543122 GGCCTCCAGGGACCCCCACCTGG + Intergenic
1182128690 22:27834970-27834992 GTTTCCCAGAGGTCCCCAGCAGG - Intergenic
1183315534 22:37135066-37135088 GTTCCACAGGGCCCCCCTGTGGG + Intronic
1183418498 22:37696787-37696809 GCTCCCTGGGGACCCCCAGCGGG + Intronic
1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG + Intronic
1183964087 22:41430919-41430941 ACTCCCCAGGGAGCCCCATCAGG - Intergenic
1183975949 22:41512480-41512502 CTTGCCCAGGGACACCTAGCTGG + Intronic
1184088450 22:42279949-42279971 GCTCCCCAGAGGCCCCCAGAGGG - Intronic
1184414344 22:44343580-44343602 CTGCCCCAGGGTCCCCGAGCTGG - Intergenic
1184446392 22:44549844-44549866 TCTCCCCTGGGGCCCCCAGCAGG + Intergenic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
1203283001 22_KI270734v1_random:140483-140505 GCTCCCCAGCCACCCACAGCAGG + Intergenic
950160596 3:10757915-10757937 TTTCCCCAGGGTCACACAGCTGG + Intergenic
950881803 3:16328368-16328390 GTTCCCAAAGGGCCACCAGCAGG - Intronic
952924767 3:38312939-38312961 GATGCCCAGAGACCCCCTGCTGG - Intronic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
953908768 3:46881783-46881805 CCTCCCCAGGGACCCCGACCCGG + Intronic
954139712 3:48598617-48598639 GTCCACCAGGGACCACCAGGGGG + Intergenic
954331955 3:49895929-49895951 GTTTCCCAGGGAGGTCCAGCTGG + Intronic
954422787 3:50427342-50427364 CATCCCTGGGGACCCCCAGCTGG + Intronic
954438343 3:50507946-50507968 GGTCCCCAAGGGCCCCCAGCTGG + Intergenic
956231989 3:67027873-67027895 CTTCCCCAGAGACCTTCAGCAGG - Intergenic
956797224 3:72728039-72728061 GTTCCCCAGGGCTCTCCAGTGGG + Intergenic
957154487 3:76530242-76530264 TTTCCCCCTGGACTCCCAGCTGG + Intronic
957813064 3:85253920-85253942 ATTCTCCAGGGAACACCAGCTGG + Intronic
957939944 3:86991324-86991346 CTTCCCCGGGGTCCCCCTGCAGG - Intergenic
960942314 3:122943060-122943082 GGTGCCCAGGGGCCCCCTGCCGG - Intronic
960971978 3:123146295-123146317 GGTCTCCAGGGGCCGCCAGCTGG - Intronic
961093818 3:124138033-124138055 GATCCCCAGTGGCCCCCAGCAGG + Intronic
961463442 3:127067569-127067591 GTTTCCCAAGGCCCCACAGCAGG + Intergenic
962320868 3:134389301-134389323 GTCTCCCAGGGAACTCCAGCTGG - Intergenic
963647380 3:147932386-147932408 GTTTTCCAGGGAGGCCCAGCAGG + Intergenic
967153300 3:186669275-186669297 TTTACCCAAGGACCCACAGCTGG - Intronic
968281366 3:197479336-197479358 GTTATCCAGGGACTCCCAGCGGG + Intergenic
968816480 4:2824263-2824285 GTACCCCAGGGAGGCCAAGCAGG + Intronic
969234976 4:5859343-5859365 GCTCCCCAGGGTCTCACAGCTGG + Intronic
969373875 4:6750493-6750515 CTTCCCCAGGGAGCCACTGCAGG + Intergenic
969394432 4:6910866-6910888 GATGCCCAGGGACCTCCAGTAGG - Intronic
969412047 4:7034715-7034737 GCTCCCCGGTGACCCACAGCTGG - Intergenic
969583450 4:8078678-8078700 GTTGCCCAGGGTCACACAGCTGG - Intronic
969626126 4:8306619-8306641 GTCCTCCAGGGACCCCAGGCTGG - Exonic
970325593 4:14920265-14920287 GTTCTTCAGGGAACCCCCGCTGG - Intergenic
975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG + Exonic
975593465 4:76023593-76023615 CTTCCCCAGGAACAGCCAGCAGG - Intronic
976152469 4:82105960-82105982 GTTCTCCAGGGAACCCCATGTGG - Intergenic
977340338 4:95749818-95749840 GTTCTCCAGGGAGCACCAGAAGG - Intergenic
978379403 4:108111351-108111373 GGTCCCCAGGTACACTCAGCAGG - Intronic
979188165 4:117824605-117824627 GGTCACCAGGCACCCCCACCCGG + Intergenic
984717793 4:182942067-182942089 ATTCTCTATGGACCCCCAGCGGG - Intergenic
984919749 4:184753039-184753061 GCTCCCCAGGGACCCCTCCCAGG - Intergenic
985542784 5:494503-494525 GCACCATAGGGACCCCCAGCAGG - Intronic
985718044 5:1473643-1473665 GTCTCCAAGGGACCCCCTGCAGG - Intronic
985855485 5:2421374-2421396 GTTCCACAGGGAACAGCAGCTGG + Intergenic
985949952 5:3215411-3215433 GTTCCCCAGAGGGCCCCAGGAGG + Intergenic
986136450 5:4984026-4984048 GTTCCCCCAGCAGCCCCAGCAGG + Intergenic
986258416 5:6121492-6121514 GTTCCCCAAGGCCACACAGCTGG + Intergenic
988717281 5:33840736-33840758 GATCCCCAGGGCCACCCTGCAGG + Intronic
993272287 5:85811459-85811481 GGACCACAGGGAACCCCAGCTGG - Intergenic
995031828 5:107490001-107490023 GATCTCCAGGGTCCCTCAGCTGG + Intronic
998092666 5:139380320-139380342 GGGCCCCAGGCAGCCCCAGCAGG + Exonic
1001082447 5:168677180-168677202 CTTGCCCAGGGTCCCTCAGCTGG - Intronic
1001638345 5:173228586-173228608 GTTGCCCAGGGTCACACAGCTGG - Intergenic
1004273996 6:14219942-14219964 TTTTCCCAGGGTCACCCAGCCGG + Intergenic
1005806631 6:29479359-29479381 GTTCCCAAGGTAGCCCCAGTGGG - Intergenic
1005963135 6:30707576-30707598 GATCCCCAGTGAGCCCCAGGAGG - Exonic
1005990153 6:30897514-30897536 GTTCCTCAGTGCCCACCAGCTGG + Exonic
1006592792 6:35170434-35170456 GGTCCCCTGGGGCCCCCAGCAGG - Intergenic
1006615171 6:35321271-35321293 GTTGCCCTGGGATCCCCAGCGGG - Exonic
1007284600 6:40738399-40738421 TGTCCCCAGGGAGCCCCAGCCGG - Intergenic
1007738207 6:43994865-43994887 TGTCCTCAGGGACCCCCAGTCGG + Intergenic
1007789870 6:44302813-44302835 GCTCCCCAGTGACGGCCAGCAGG + Exonic
1008726449 6:54427240-54427262 TTTCCCCAGGCTCCCTCAGCAGG - Intergenic
1008900303 6:56606598-56606620 GTTCCCCAGGGGGCACCAGTTGG - Intronic
1009950624 6:70391658-70391680 GTCCCCCAGAGTTCCCCAGCAGG + Intergenic
1010013754 6:71080455-71080477 GTTCCCTAGGGTTGCCCAGCTGG - Intergenic
1010090818 6:71979386-71979408 TTGCCCCAGGGTCACCCAGCAGG + Intronic
1013170697 6:107634590-107634612 GTCCCCCCGGGACTCCAAGCAGG + Exonic
1013300867 6:108803854-108803876 GGTCACCAGGGACCTCCATCTGG - Intergenic
1013841716 6:114404080-114404102 GTTCCCCATGGACACCTTGCAGG + Intergenic
1015796401 6:137016241-137016263 TGTCCCCATGGAGCCCCAGCTGG - Intronic
1016369903 6:143362632-143362654 GTTCTCAAAGGCCCCCCAGCGGG - Intergenic
1018908711 6:168089688-168089710 GTTCCTGAGGGCCGCCCAGCGGG + Intergenic
1019469602 7:1211695-1211717 GCTCCCCCGGGGCCCACAGCAGG + Intergenic
1019522842 7:1468406-1468428 GTTCCCCAGGAGCCCACAGAGGG + Intergenic
1019658007 7:2207956-2207978 GTTCTCCAGGGGTCACCAGCTGG - Intronic
1019682590 7:2359817-2359839 GTTCTCCAGGGGCCACCAGCTGG - Intronic
1019747655 7:2709562-2709584 GATCCCCAGGCAGCCCCAGCAGG - Intronic
1023771461 7:43560485-43560507 GTTCCCCAAGGACTGCCAGGAGG + Intronic
1025709959 7:63899910-63899932 GTGCCCCTTGGACCCCGAGCTGG - Intergenic
1026470575 7:70691704-70691726 GCTCCCCAGGGTCCCCTGGCTGG - Intronic
1027151758 7:75738611-75738633 GGACCCCAGGGTACCCCAGCTGG - Intronic
1027165306 7:75829971-75829993 AATCCCCAGGGAGCCCCAGGGGG + Intergenic
1027165837 7:75833773-75833795 AATCCCCAGGGAGCCCCAGGGGG - Intergenic
1034488898 7:151382416-151382438 GCACCCCCGGGACCCCTAGCGGG + Intronic
1035400108 7:158559095-158559117 GTTCTCCCGGAGCCCCCAGCAGG + Intronic
1035755634 8:2029053-2029075 GCTCCCCAGGGACCCCAAAGAGG - Intergenic
1037915981 8:22773751-22773773 GTTCCCTTGGGAGCCTCAGCCGG + Intronic
1038170594 8:25128256-25128278 GTTCCCCAGAGTCCACCCGCTGG - Intergenic
1038419551 8:27423678-27423700 ATTCCCCAGTGCCCCTCAGCTGG - Intronic
1039299240 8:36191571-36191593 GTTCTCCAGTGAACACCAGCTGG - Intergenic
1039835543 8:41253610-41253632 TTTCCCCAGGGAGCCCCACCAGG + Intergenic
1041196703 8:55408454-55408476 GTGGCCCAGGGAACCGCAGCAGG + Intronic
1041983727 8:63894703-63894725 GAAAGCCAGGGACCCCCAGCTGG + Intergenic
1046239689 8:111475012-111475034 AGTCATCAGGGACCCCCAGCCGG + Intergenic
1047193292 8:122698388-122698410 GTTTCCCAGGTGCCCACAGCAGG + Intergenic
1047780199 8:128104866-128104888 CTTGCCCAAGGTCCCCCAGCAGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049542112 8:143213380-143213402 GACCTCCAGGGACCCCCAGCAGG + Intergenic
1053294088 9:36900817-36900839 GTACCCCAGGGACACTCAGGTGG - Intronic
1053647345 9:40131173-40131195 GCCCCTCTGGGACCCCCAGCAGG - Intergenic
1053758382 9:41332670-41332692 GCCCCTCTGGGACCCCCAGCAGG + Intergenic
1054537234 9:66244997-66245019 GCCCCTCTGGGACCCCCAGCAGG + Intergenic
1055498549 9:76880318-76880340 GTTACCCAGGGACCCCCCTGCGG - Intronic
1056216278 9:84408638-84408660 GGTGCGCAGGGTCCCCCAGCAGG + Intergenic
1056306326 9:85294439-85294461 GTTCCTCAGGGATCCTCTGCTGG + Intergenic
1057126142 9:92617665-92617687 GTCCCCCGGTAACCCCCAGCGGG - Exonic
1057830632 9:98403480-98403502 GTCTCCCAGGGACACACAGCTGG - Intronic
1057897349 9:98919893-98919915 CTTCCCCAGGGCCATCCAGCAGG + Intergenic
1057928270 9:99171417-99171439 GTCCCCCATGGTCCTCCAGCTGG + Intergenic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1058926270 9:109667070-109667092 GTTCTTCAAGGACCCACAGCTGG + Intronic
1060205539 9:121680614-121680636 GTTCCCTAGGGTCCCCCTGAAGG - Intronic
1060219367 9:121756251-121756273 TTTCCCCAGGGCCACACAGCAGG + Intronic
1060398245 9:123331503-123331525 GTTGCCCAGGGCCACACAGCTGG - Intergenic
1060828711 9:126700743-126700765 GCTCCCATGGGACCCCCAGGTGG - Exonic
1061259262 9:129470685-129470707 GTGACCCAGGGACCACCTGCAGG - Intergenic
1061498953 9:130991390-130991412 GTCCCCCAGGGGCCTCCACCAGG + Intergenic
1061761749 9:132856348-132856370 TTTGCCCAGGGTCGCCCAGCTGG - Intronic
1062324026 9:136004010-136004032 GTTCCCCAGGGAGCCCCAAGGGG + Intergenic
1062516456 9:136939420-136939442 GGTCCCCAGGGCTTCCCAGCTGG + Intronic
1185701417 X:2233505-2233527 TCTCCCCAGCGCCCCCCAGCCGG - Intronic
1187680190 X:21759992-21760014 GTTTCCCAGAGGTCCCCAGCAGG + Intergenic
1187830006 X:23371417-23371439 GTTTCCCAGAGTTCCCCAGCAGG - Intronic
1188242990 X:27811167-27811189 CTTCCCCAGGGACCCCTATCAGG - Intronic
1189259044 X:39664605-39664627 ATTGCCCAAGGACACCCAGCTGG - Intergenic
1190452635 X:50596511-50596533 CTTCCCCAGGGTCTCCTAGCTGG + Exonic
1190792672 X:53714689-53714711 TTTCACCAGGGACACCCTGCAGG + Intergenic
1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG + Intronic
1195269366 X:103215248-103215270 CAACCCCAGGGACCCCCCGCCGG - Intronic
1196782781 X:119398702-119398724 CTTCCCCAAGGTCCCACAGCTGG + Intergenic
1199532603 X:148867320-148867342 CTTCTCCAGGGACCTCCAGGTGG - Intronic
1199609534 X:149600928-149600950 GTTGCCAAAGTACCCCCAGCAGG - Intronic
1199629582 X:149768426-149768448 GTTGCCAAAGTACCCCCAGCAGG + Intergenic
1199713294 X:150487645-150487667 CTTCCCCAGGGCCCCTCACCTGG + Intronic
1199980772 X:152919270-152919292 GTTCTCAAGGGCCCCTCAGCTGG - Intronic
1199984059 X:152937819-152937841 CTTCCCCAGGGAACCCAAGTTGG + Intronic
1200142767 X:153910072-153910094 GAACCTCAGGGACGCCCAGCTGG - Exonic