ID: 953075175

View in Genome Browser
Species Human (GRCh38)
Location 3:39563096-39563118
Sequence TGCTTCCACTTGAGTCAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953075173_953075175 13 Left 953075173 3:39563060-39563082 CCAGCACGGGGCTGAATTGCCTA No data
Right 953075175 3:39563096-39563118 TGCTTCCACTTGAGTCAATATGG No data
953075174_953075175 -6 Left 953075174 3:39563079-39563101 CCTAGTGACATAGCTTCTGCTTC No data
Right 953075175 3:39563096-39563118 TGCTTCCACTTGAGTCAATATGG No data
953075172_953075175 23 Left 953075172 3:39563050-39563072 CCACTCTCTTCCAGCACGGGGCT No data
Right 953075175 3:39563096-39563118 TGCTTCCACTTGAGTCAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953075175 Original CRISPR TGCTTCCACTTGAGTCAATA TGG Intergenic
No off target data available for this crispr