ID: 953076340

View in Genome Browser
Species Human (GRCh38)
Location 3:39573954-39573976
Sequence CTGAGTGAGAACTTCTATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953076340_953076344 8 Left 953076340 3:39573954-39573976 CCGGGATAGAAGTTCTCACTCAG No data
Right 953076344 3:39573985-39574007 TCTGTTTGGAACTGGCAGCTTGG No data
953076340_953076342 -6 Left 953076340 3:39573954-39573976 CCGGGATAGAAGTTCTCACTCAG No data
Right 953076342 3:39573971-39573993 ACTCAGTTGTGGACTCTGTTTGG No data
953076340_953076343 0 Left 953076340 3:39573954-39573976 CCGGGATAGAAGTTCTCACTCAG No data
Right 953076343 3:39573977-39573999 TTGTGGACTCTGTTTGGAACTGG No data
953076340_953076345 16 Left 953076340 3:39573954-39573976 CCGGGATAGAAGTTCTCACTCAG No data
Right 953076345 3:39573993-39574015 GAACTGGCAGCTTGGTTTTCAGG 0: 8
1: 27
2: 82
3: 114
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953076340 Original CRISPR CTGAGTGAGAACTTCTATCC CGG (reversed) Intergenic
No off target data available for this crispr