ID: 953085761

View in Genome Browser
Species Human (GRCh38)
Location 3:39665167-39665189
Sequence ATGTCTTAGCTGAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953085756_953085761 0 Left 953085756 3:39665144-39665166 CCAAAGGTAAGCAGAAATTATAC No data
Right 953085761 3:39665167-39665189 ATGTCTTAGCTGAATGGGGAGGG No data
953085755_953085761 4 Left 953085755 3:39665140-39665162 CCAACCAAAGGTAAGCAGAAATT No data
Right 953085761 3:39665167-39665189 ATGTCTTAGCTGAATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953085761 Original CRISPR ATGTCTTAGCTGAATGGGGA GGG Intergenic
No off target data available for this crispr