ID: 953091065

View in Genome Browser
Species Human (GRCh38)
Location 3:39726502-39726524
Sequence TCCCCACTTCAGCTTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953091065_953091072 27 Left 953091065 3:39726502-39726524 CCTCCTTTAAGCTGAAGTGGGGA No data
Right 953091072 3:39726552-39726574 GGAGCACATCCTGCACTGGCTGG No data
953091065_953091068 6 Left 953091065 3:39726502-39726524 CCTCCTTTAAGCTGAAGTGGGGA No data
Right 953091068 3:39726531-39726553 TTCATCTTGAGACAGTCCCTTGG No data
953091065_953091071 23 Left 953091065 3:39726502-39726524 CCTCCTTTAAGCTGAAGTGGGGA No data
Right 953091071 3:39726548-39726570 CCTTGGAGCACATCCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953091065 Original CRISPR TCCCCACTTCAGCTTAAAGG AGG (reversed) Intergenic
No off target data available for this crispr