ID: 953091953

View in Genome Browser
Species Human (GRCh38)
Location 3:39736800-39736822
Sequence CTGGAAACCTACAATTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953091953_953091957 1 Left 953091953 3:39736800-39736822 CCACCATAATTGTAGGTTTCCAG No data
Right 953091957 3:39736824-39736846 GGCCTCCCCAGAAGCTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953091953 Original CRISPR CTGGAAACCTACAATTATGG TGG (reversed) Intergenic
No off target data available for this crispr