ID: 953091957

View in Genome Browser
Species Human (GRCh38)
Location 3:39736824-39736846
Sequence GGCCTCCCCAGAAGCTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953091950_953091957 11 Left 953091950 3:39736790-39736812 CCTTCACCTTCCACCATAATTGT 0: 42
1: 734
2: 1771
3: 3767
4: 4909
Right 953091957 3:39736824-39736846 GGCCTCCCCAGAAGCTGAACAGG No data
953091952_953091957 5 Left 953091952 3:39736796-39736818 CCTTCCACCATAATTGTAGGTTT No data
Right 953091957 3:39736824-39736846 GGCCTCCCCAGAAGCTGAACAGG No data
953091953_953091957 1 Left 953091953 3:39736800-39736822 CCACCATAATTGTAGGTTTCCAG No data
Right 953091957 3:39736824-39736846 GGCCTCCCCAGAAGCTGAACAGG No data
953091954_953091957 -2 Left 953091954 3:39736803-39736825 CCATAATTGTAGGTTTCCAGAGG No data
Right 953091957 3:39736824-39736846 GGCCTCCCCAGAAGCTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953091957 Original CRISPR GGCCTCCCCAGAAGCTGAAC AGG Intergenic
No off target data available for this crispr