ID: 953093107

View in Genome Browser
Species Human (GRCh38)
Location 3:39749255-39749277
Sequence ATCTATGAACAGTGGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953093107_953093109 -10 Left 953093107 3:39749255-39749277 CCATGCTTCCACTGTTCATAGAT No data
Right 953093109 3:39749268-39749290 GTTCATAGATGAAGAAACTGAGG No data
953093107_953093111 11 Left 953093107 3:39749255-39749277 CCATGCTTCCACTGTTCATAGAT No data
Right 953093111 3:39749289-39749311 GGCTCAGAGAACTTCTGCCAGGG No data
953093107_953093110 10 Left 953093107 3:39749255-39749277 CCATGCTTCCACTGTTCATAGAT No data
Right 953093110 3:39749288-39749310 AGGCTCAGAGAACTTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953093107 Original CRISPR ATCTATGAACAGTGGAAGCA TGG (reversed) Intergenic
No off target data available for this crispr