ID: 953095674

View in Genome Browser
Species Human (GRCh38)
Location 3:39773189-39773211
Sequence TTTGTTGCACAACAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953095666_953095674 18 Left 953095666 3:39773148-39773170 CCATTCTCTAATAAAAGAAACCA No data
Right 953095674 3:39773189-39773211 TTTGTTGCACAACAGGAGCTGGG No data
953095670_953095674 -2 Left 953095670 3:39773168-39773190 CCAATGGTCCTTGGAAAATGGTT No data
Right 953095674 3:39773189-39773211 TTTGTTGCACAACAGGAGCTGGG No data
953095671_953095674 -10 Left 953095671 3:39773176-39773198 CCTTGGAAAATGGTTTGTTGCAC No data
Right 953095674 3:39773189-39773211 TTTGTTGCACAACAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953095674 Original CRISPR TTTGTTGCACAACAGGAGCT GGG Intergenic
No off target data available for this crispr