ID: 953097503

View in Genome Browser
Species Human (GRCh38)
Location 3:39792979-39793001
Sequence CTGAATTTACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953097503_953097505 -3 Left 953097503 3:39792979-39793001 CCATTGTCCATTTGTAAATTCAG No data
Right 953097505 3:39792999-39793021 CAGTGTCTTGATTTCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953097503 Original CRISPR CTGAATTTACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr