ID: 953098402

View in Genome Browser
Species Human (GRCh38)
Location 3:39801675-39801697
Sequence TCTATTTCTGTTTTTTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953098402_953098403 3 Left 953098402 3:39801675-39801697 CCTCATTAAAAAACAGAAATAGA No data
Right 953098403 3:39801701-39801723 GTGTGTAAAAAAGCCATGACAGG No data
953098402_953098406 27 Left 953098402 3:39801675-39801697 CCTCATTAAAAAACAGAAATAGA No data
Right 953098406 3:39801725-39801747 TGTCATGTTGAGGTTATATAAGG No data
953098402_953098405 17 Left 953098402 3:39801675-39801697 CCTCATTAAAAAACAGAAATAGA No data
Right 953098405 3:39801715-39801737 CATGACAGGATGTCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953098402 Original CRISPR TCTATTTCTGTTTTTTAATG AGG (reversed) Intergenic
No off target data available for this crispr