ID: 953098403

View in Genome Browser
Species Human (GRCh38)
Location 3:39801701-39801723
Sequence GTGTGTAAAAAAGCCATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953098402_953098403 3 Left 953098402 3:39801675-39801697 CCTCATTAAAAAACAGAAATAGA No data
Right 953098403 3:39801701-39801723 GTGTGTAAAAAAGCCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953098403 Original CRISPR GTGTGTAAAAAAGCCATGAC AGG Intergenic
No off target data available for this crispr