ID: 953098694

View in Genome Browser
Species Human (GRCh38)
Location 3:39805027-39805049
Sequence ATAACAATCTTACAGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953098690_953098694 -6 Left 953098690 3:39805010-39805032 CCACATACATTGTATCAATAACA No data
Right 953098694 3:39805027-39805049 ATAACAATCTTACAGGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953098694 Original CRISPR ATAACAATCTTACAGGGTGG TGG Intergenic
No off target data available for this crispr