ID: 953100487

View in Genome Browser
Species Human (GRCh38)
Location 3:39820931-39820953
Sequence CAACCCAAGCAGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 297}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953100487_953100489 -10 Left 953100487 3:39820931-39820953 CCATCCACTTTCTGCTTGGGTTG 0: 1
1: 0
2: 2
3: 29
4: 297
Right 953100489 3:39820944-39820966 GCTTGGGTTGCTTTTCCCTCAGG 0: 1
1: 0
2: 5
3: 33
4: 210
953100487_953100493 6 Left 953100487 3:39820931-39820953 CCATCCACTTTCTGCTTGGGTTG 0: 1
1: 0
2: 2
3: 29
4: 297
Right 953100493 3:39820960-39820982 CCTCAGGCTGCTGCTGATGGTGG 0: 1
1: 1
2: 6
3: 52
4: 425
953100487_953100494 10 Left 953100487 3:39820931-39820953 CCATCCACTTTCTGCTTGGGTTG 0: 1
1: 0
2: 2
3: 29
4: 297
Right 953100494 3:39820964-39820986 AGGCTGCTGCTGATGGTGGATGG 0: 1
1: 0
2: 7
3: 73
4: 601
953100487_953100495 11 Left 953100487 3:39820931-39820953 CCATCCACTTTCTGCTTGGGTTG 0: 1
1: 0
2: 2
3: 29
4: 297
Right 953100495 3:39820965-39820987 GGCTGCTGCTGATGGTGGATGGG 0: 1
1: 0
2: 2
3: 37
4: 286
953100487_953100496 12 Left 953100487 3:39820931-39820953 CCATCCACTTTCTGCTTGGGTTG 0: 1
1: 0
2: 2
3: 29
4: 297
Right 953100496 3:39820966-39820988 GCTGCTGCTGATGGTGGATGGGG 0: 1
1: 0
2: 9
3: 87
4: 769
953100487_953100490 3 Left 953100487 3:39820931-39820953 CCATCCACTTTCTGCTTGGGTTG 0: 1
1: 0
2: 2
3: 29
4: 297
Right 953100490 3:39820957-39820979 TTCCCTCAGGCTGCTGCTGATGG 0: 1
1: 0
2: 3
3: 47
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953100487 Original CRISPR CAACCCAAGCAGAAAGTGGA TGG (reversed) Intronic
901296567 1:8165547-8165569 CACCCCAACCATAAAGGGGATGG - Intergenic
902255589 1:15186879-15186901 CAGACCAAGCAGAAAGTAGGGGG + Intronic
903670768 1:25034180-25034202 CAGCCCCAGCAGGAAGTGGCTGG + Intergenic
904752312 1:32748675-32748697 TTACCCAAGAAGAAAGTGGCTGG - Intronic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905136515 1:35804680-35804702 CAGCCACAGCAGGAAGTGGAGGG + Intergenic
905299328 1:36975748-36975770 GCACCAAAGGAGAAAGTGGAGGG - Intronic
906323995 1:44832985-44833007 CCACTCAGGCAGAAAGTGCATGG + Intronic
908112262 1:60909167-60909189 AAACCCAAACAGAAAGCAGAGGG + Intronic
909566490 1:77058537-77058559 CACTCCTAGCAGAAAGTGAAGGG - Intronic
911121023 1:94296634-94296656 AAACCCCACCAGAAAGTAGAGGG + Intergenic
911726228 1:101244103-101244125 GAATCCAAGAAGAAAGTGTAGGG - Intergenic
911991253 1:104699542-104699564 AAACCAAAGCAAACAGTGGAAGG + Intergenic
912665851 1:111578870-111578892 AAATCCCAGCAGAAAGTTGAGGG - Intronic
912795057 1:112688364-112688386 GAACCCAAGCAGGAAGGGAAAGG - Intronic
913187032 1:116378184-116378206 CAAACCAAAGAGAAAGTGTAGGG - Intronic
913337860 1:117725985-117726007 CAACCCCATCAAAAAGTGGGTGG + Intergenic
913471301 1:119190013-119190035 GAACCAAAGAAGAAAGTGCATGG - Intergenic
913546676 1:119875733-119875755 CAACCCCATCAAAAAGTGGGAGG + Intergenic
915454343 1:156029545-156029567 CACCCCAAGTTGAAAGTGGATGG + Intergenic
916027028 1:160841912-160841934 GAACCCAAGCTGAAAGTAGCGGG + Intronic
917037274 1:170762544-170762566 CAACCCCATCAAAAAGTGGGAGG + Intergenic
917892640 1:179454337-179454359 CAACCATAGCAGAAGGTGAAAGG - Intronic
919242613 1:194934920-194934942 CAATCATGGCAGAAAGTGGAAGG - Intergenic
920825987 1:209424666-209424688 CCACCCAAGGAGTAAGTGGAAGG - Intergenic
921745073 1:218731233-218731255 CAACCAAAGCAGCAAGAAGATGG + Intergenic
923634211 1:235679370-235679392 GAACCCAAGCAGAAAAGGAAGGG - Intronic
924258254 1:242203654-242203676 CAATCCAGGCAGAAGGTGAAGGG - Intronic
1063260713 10:4386330-4386352 CCACTCAACCATAAAGTGGAGGG - Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065664936 10:28048968-28048990 CATCTCAAGCAGAAAGATGAGGG + Intergenic
1065868386 10:29934158-29934180 CAACCCTCACAAAAAGTGGACGG + Intergenic
1069621863 10:69842278-69842300 CAACCCTGGCAGAAGGTGAAAGG - Intronic
1069694365 10:70376019-70376041 CATCCCATGAAGAAAGGGGACGG - Intronic
1069955724 10:72050192-72050214 CAAGACAAGCAGAAACTGGTGGG + Intergenic
1070316783 10:75321173-75321195 CAATCCAAGTAGAAGGTGAAGGG - Intergenic
1071663136 10:87526370-87526392 CAACCCCATCAAAAAGTGGGTGG - Intronic
1071871138 10:89795973-89795995 CAACCAAGGCAGAAGGTGAAGGG + Intergenic
1072180755 10:92977245-92977267 CATTCCAAGCAGAGAGAGGATGG - Intronic
1073974226 10:109082233-109082255 CAATGCAAGCAGAAAGTGAAAGG + Intergenic
1074049261 10:109867489-109867511 AAAGCTAAGCAGGAAGTGGATGG + Intronic
1076479623 10:130776383-130776405 CAACAAAGGCAGAAAGTGAAGGG - Intergenic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078442208 11:11377457-11377479 CTTCCCCAGCAGAAAGAGGAAGG + Intronic
1078872139 11:15357567-15357589 CAACCCAAAGAGAAAGTTGTGGG + Intergenic
1081017799 11:37905748-37905770 CAACCCATGCTGAAGTTGGAGGG + Intergenic
1081697256 11:45123168-45123190 CAACCCTATCAAAAAGTGGGGGG - Intronic
1082137156 11:48562406-48562428 CAACCCCATCAAAAAGTGGGGGG - Intergenic
1083105503 11:60354431-60354453 CAAACATGGCAGAAAGTGGAAGG - Intronic
1086757610 11:90583398-90583420 CAACTCACCCAGGAAGTGGAAGG - Intergenic
1087923566 11:103894326-103894348 AAACCCAAGCAGACAATGGACGG + Intergenic
1089729188 11:120510184-120510206 TAAGCCTAGCAGAAAGTGTACGG - Intergenic
1089839060 11:121398497-121398519 CAAACCAAGAATAAAGTAGAAGG + Intergenic
1090636971 11:128695198-128695220 CAACCCAGGCGGAAAGGTGAGGG + Intronic
1092439502 12:8485984-8486006 CACTCCTAGCAGAAAGTGAAGGG - Intergenic
1092596643 12:10012937-10012959 CAATCCAAGCTGAAAGTACATGG - Intronic
1092691345 12:11113820-11113842 CAACCCCATCAAAAAGTGGGTGG + Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093514690 12:19972434-19972456 CAACCCAGGGAGAAAGTAAAGGG - Intergenic
1096216059 12:49797869-49797891 CATCCCCAGCAGAAAGGGGTTGG + Intronic
1099011527 12:77297039-77297061 AAACCCAGGCAGACAGTCGATGG - Intergenic
1099081350 12:78186462-78186484 CAGCTCAAGCAGAAAGTTGATGG - Intronic
1099946817 12:89254499-89254521 GGACCGAACCAGAAAGTGGAAGG + Intergenic
1100124472 12:91407034-91407056 CATCCAAAGCAGAATGTGGCTGG + Intergenic
1100972435 12:100084600-100084622 CAACCAAAACAAAAAATGGATGG - Exonic
1101670813 12:106870954-106870976 GAAACCAAGCAAAAAATGGATGG - Intronic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1102619792 12:114185004-114185026 TCACCCAACCAGAAAGTGGCAGG + Intergenic
1102642312 12:114377980-114378002 CCACCCAACCAGAGAGTGGATGG - Intronic
1104264764 12:127220864-127220886 CACCCCAAGCCGAAAGTGTAGGG - Intergenic
1104269568 12:127270737-127270759 CCACTCAAGCAGATAGTGGAGGG - Intergenic
1105787079 13:23759969-23759991 CAAACCTGGCAGAAAGTGGCAGG - Intronic
1108472148 13:50778150-50778172 CAATCATAGCAGAAAGTGAAGGG + Intronic
1110940681 13:81344367-81344389 TAACCAAACCACAAAGTGGAAGG + Intergenic
1112835728 13:103512040-103512062 GAATCTAAGCAGAAAGAGGAGGG + Intergenic
1115182661 14:30647544-30647566 CAAAGCAGGCAGAAACTGGAGGG - Intronic
1115470809 14:33766717-33766739 CAACTCAGGAAGTAAGTGGATGG - Intronic
1115939822 14:38596271-38596293 CAACCCCATCAAAAAGTGGGTGG - Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117845862 14:59911403-59911425 CAACTTAAGAAGAAAGTGTATGG - Intergenic
1117881712 14:60319102-60319124 CAATCATGGCAGAAAGTGGAGGG - Intergenic
1118156926 14:63251533-63251555 AAACCCAAAGAGAAAGGGGAAGG + Intronic
1118452102 14:65912592-65912614 CTTCCCAAACAGTAAGTGGAGGG + Intergenic
1118477140 14:66128133-66128155 CAAGCCAAGCATCAAATGGATGG + Intergenic
1118591519 14:67405572-67405594 CAACCCTAGTAAAATGTGGAAGG - Intronic
1119643583 14:76331750-76331772 CAAACCAAGCAGAAAGAGGCAGG - Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120450845 14:84665444-84665466 CATCCCCAGGAGAAAGGGGAGGG - Intergenic
1122473494 14:101988624-101988646 CAAGTCAATCAGAAAGTGGTAGG - Intronic
1123969522 15:25493995-25494017 CAACTCAACCACAAAGTGGCAGG - Intergenic
1124051073 15:26198048-26198070 CAACCATGGCAGAAAGTGAAGGG + Intergenic
1124561082 15:30774125-30774147 TAACCCTAGTACAAAGTGGAGGG + Intergenic
1124669448 15:31624934-31624956 TAACCCTAGTACAAAGTGGAGGG - Intronic
1124970647 15:34486842-34486864 CAACCCCATCAAAAAGTGGGTGG + Intergenic
1126383758 15:48073628-48073650 CAATCAAAGCAGAAGGTGAAGGG + Intergenic
1127131848 15:55874273-55874295 CCAAACAAGCAGAAACTGGAGGG + Intronic
1127569562 15:60228650-60228672 AGACCCAAACAGAAAATGGAAGG - Intergenic
1128261510 15:66236233-66236255 CTACCCAAGCATCAAGTGCAAGG + Intronic
1129137907 15:73570733-73570755 AAACCACAGCAGAAAGAGGACGG + Intronic
1129571346 15:76688264-76688286 CAACCCCATCAAAAAGTGGGCGG - Intronic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1129886144 15:79038761-79038783 CAAGCCAAGCAGAAAGAAAATGG - Intronic
1130799414 15:87246376-87246398 CAAACAAAACAGAAAGTAGATGG - Intergenic
1130862948 15:87907750-87907772 GCCCCCAAGCAAAAAGTGGAAGG + Intronic
1130885600 15:88090085-88090107 CAAGCCGAGCAGAGAGGGGAGGG - Intronic
1131568327 15:93506461-93506483 CATCCCAGGCAGGAAGTGGCAGG - Intergenic
1131951948 15:97690798-97690820 CAATCAAGGCAGAAAGTGAAGGG + Intergenic
1132104701 15:99054907-99054929 CAAACCAAGCAGGCAGGGGAGGG - Intergenic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1132946680 16:2535542-2535564 CAACCCTGGTAGAAAGTGAACGG - Intergenic
1132969020 16:2676075-2676097 CAACCCTGGTAGAAAGTGAACGG + Intergenic
1134349194 16:13420704-13420726 CAACCCAAGATGGAATTGGAGGG + Intergenic
1135511270 16:23085993-23086015 CCACCCAAACAGACACTGGACGG + Intronic
1135815331 16:25627416-25627438 CAATCATGGCAGAAAGTGGAGGG + Intergenic
1138275168 16:55729047-55729069 CACCCCAAGGTGAAAGAGGAAGG + Intergenic
1141165136 16:81655296-81655318 CAGACCAACCAGAAGGTGGAAGG + Intronic
1141969964 16:87474570-87474592 CAAGACAAGCAGAAACTGGAGGG + Intronic
1142860478 17:2757821-2757843 CAACCCCAGCAGACAGTGCCAGG - Intergenic
1145950463 17:28812765-28812787 GTACCCAGGCAGAAAGTGGGAGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146057854 17:29589887-29589909 CACCCCACGCGGAAAGTGAAGGG - Intronic
1147262143 17:39214824-39214846 CAGCCCCAGCAGAGAGTGAAGGG - Exonic
1149930369 17:60747475-60747497 AAACCACAGCAGAAAGTGAATGG - Intronic
1149982083 17:61318705-61318727 TAACCCTAGCAGAAAGTTGCAGG - Intronic
1151012948 17:70522230-70522252 CAACCCAGCCAAAAAGTGGAAGG + Intergenic
1153105065 18:1517012-1517034 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1155065378 18:22264842-22264864 TCACCCAAGCTGGAAGTGGAGGG - Intergenic
1155096517 18:22560685-22560707 CAGCCAAAGGAGAAAGTGGAGGG - Intergenic
1155373378 18:25129646-25129668 CAACTCAATTAGAAAGTGGCGGG + Intronic
1156126516 18:33911942-33911964 CTACCCAAGTAGGAAATGGAGGG - Intronic
1156842092 18:41620891-41620913 GAATTCAAGCAGAAAGTGGATGG + Intergenic
1157010751 18:43645522-43645544 CAACCCCATCAAAAAGTGGAAGG + Intergenic
1157372891 18:47133805-47133827 CAACCCCATCAAAAAGTGGGCGG - Intronic
1157647722 18:49293645-49293667 CAACCCCATCAAAAAGTGGGAGG - Intronic
1161246126 19:3253146-3253168 CAAACCAACCAGAAGCTGGAGGG + Intronic
1164036248 19:21458352-21458374 CAACTAAAGCAGAAATTGAAAGG - Intronic
1164748627 19:30634741-30634763 CAATCCAACCAGAAAGGGGACGG + Intronic
1164852020 19:31491945-31491967 CAAGCCAAGGAGCAACTGGAGGG - Intergenic
1166209741 19:41298598-41298620 CAAACGAAGGAGTAAGTGGAGGG + Intronic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1167869461 19:52355688-52355710 CAACCCAAGAAGGGAGTCGAGGG - Intronic
1168447312 19:56431445-56431467 TAACCCCAGCAGAAAGAGGCTGG + Intronic
1168605226 19:57753452-57753474 CAACACAATCAGAAATTGAATGG + Exonic
926152188 2:10431481-10431503 CTACCCAAGCAGAAAATGCCTGG - Intergenic
926471990 2:13271974-13271996 CAACCCCATCAAAAAGTGGGCGG - Intergenic
926638743 2:15212398-15212420 CACCAAAAGAAGAAAGTGGAAGG - Intronic
926939084 2:18116064-18116086 CAATCAAAGCAGAAGGTGAAAGG - Intronic
927220507 2:20703755-20703777 CAACCCAAGAAGGCAGTGAAGGG - Intronic
928251800 2:29687277-29687299 TAAGCCAAGCAGAAAGAGGTAGG + Intronic
930849394 2:55942480-55942502 CAACCCAATAACAAAGTGGTCGG - Intergenic
931164662 2:59733563-59733585 CAGTCCCAGCAGAAAGTGGACGG + Intergenic
931763059 2:65433046-65433068 CAACCCAACCAGAGAGGGGAGGG + Intergenic
934060653 2:88289564-88289586 CAAAGCAAGCAGAAACTGGAAGG + Intergenic
935791349 2:106593091-106593113 TAATGCAAGCAGAAACTGGAGGG - Intergenic
937854052 2:126660093-126660115 CAACCCAAGGAGAGAGTTGCAGG + Intronic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940980919 2:160002287-160002309 CAACTCAAGCAGCACTTGGAAGG + Intronic
941005880 2:160246443-160246465 CAAGTCAAGTAGAACGTGGAAGG - Intronic
945060217 2:205902328-205902350 CGACCCAAACTGAAAGTCGATGG + Intergenic
945275790 2:207986269-207986291 AAGCCAGAGCAGAAAGTGGATGG + Intronic
946476177 2:220008677-220008699 CAAGCAAATCAGAAAGTGGTGGG - Intergenic
946724885 2:222652403-222652425 CAATCCTAGCACAATGTGGAAGG - Intronic
946965976 2:225038550-225038572 CTACCCACCCAGAAAGTGTAAGG - Intronic
947501945 2:230677262-230677284 CATCCCAAGAAGAAAGTGACTGG - Intergenic
947667724 2:231917825-231917847 GAACCCAAGCAGCAAGCGGGAGG - Intergenic
948305335 2:236942779-236942801 CAACCTCAGCTGAAAGTGGGTGG - Intergenic
948507612 2:238440470-238440492 CAACACAGGCAGTATGTGGAGGG - Intronic
1169331011 20:4716503-4716525 CAACCCAAGTGGAAAATGCAGGG - Intergenic
1170494152 20:16908260-16908282 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1173456489 20:43206573-43206595 CAATCATGGCAGAAAGTGGAGGG + Intergenic
1174060099 20:47826533-47826555 CACCCCAAGCAGGAGGTGGCAGG + Intergenic
1176703715 21:10092937-10092959 GAAGCCAAGAAGAAAGTGAAGGG - Intergenic
1176813901 21:13576860-13576882 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1178922169 21:36745869-36745891 AACCCCAGGCAGAAGGTGGAAGG + Intronic
1183293412 22:37016571-37016593 CAACCTAAGAAATAAGTGGAAGG - Intronic
1184887260 22:47354019-47354041 CACCCCAGGCAGATAGTGGTGGG + Intergenic
1185093471 22:48790945-48790967 CAAGCCATGCAGAGAGAGGAAGG - Intronic
950631789 3:14286849-14286871 TAACCAAAGGAGAGAGTGGAAGG + Intergenic
950631793 3:14286874-14286896 GAACCAAAGGAGAGAGTGGAAGG + Intergenic
951373666 3:21886534-21886556 AAACTCAAGCAGATATTGGATGG + Intronic
951436081 3:22666362-22666384 AAACCCAACCAGAAAGTGGAGGG + Intergenic
951448194 3:22806556-22806578 CAACCCCATCAAAAAGTGGGCGG + Intergenic
953100487 3:39820931-39820953 CAACCCAAGCAGAAAGTGGATGG - Intronic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953586053 3:44201974-44201996 CAACCCCAGCTGCAAGTGTAGGG - Intergenic
956225053 3:66947861-66947883 AAAATGAAGCAGAAAGTGGAAGG - Intergenic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
957987221 3:87587978-87588000 CAACCCCATCAAAAAGTGGGTGG + Intergenic
959492616 3:107008832-107008854 CAAACCAAGCTGAAAGTAGAAGG + Intergenic
959991188 3:112633784-112633806 CAGCCCAACTAGAAAGTGAATGG - Intronic
961024920 3:123546514-123546536 CATTCCAGGCAGAAAGTGCAAGG - Intronic
961388571 3:126538336-126538358 CATCCCAGGCAGAAAGTGAGTGG + Intronic
961627019 3:128271157-128271179 CAGCCCCAGCAGGAAGTGGGGGG - Intronic
962867536 3:139460118-139460140 CAACCAAAACAGAAAGGTGAGGG + Intronic
967443316 3:189534743-189534765 CATCCCAAGTAGATAGGGGATGG - Intergenic
968880888 4:3299447-3299469 AAAAGCAGGCAGAAAGTGGAGGG - Intronic
970361699 4:15315703-15315725 CAACCCAAATAGAAAGTCAAAGG - Intergenic
971442196 4:26699178-26699200 CAACCCCATCAAAAAGTGGGTGG + Intronic
971701762 4:29985909-29985931 AAATCCAATCAGAAAGTGGTTGG - Intergenic
973268901 4:48240379-48240401 CAACACAAGAAAAAGGTGGATGG + Intronic
973874542 4:55203724-55203746 CAACCAAAGCAGACTGTAGAGGG + Intergenic
973880671 4:55268625-55268647 AAACCCAAGCAGAAACTGCAAGG + Intergenic
975897001 4:79105369-79105391 CAATCCCATCAAAAAGTGGATGG - Intergenic
976505559 4:85842330-85842352 TCACCCAGGCAGAAAGTGGCAGG - Intronic
977086478 4:92605063-92605085 CAATCATAGCAGAAGGTGGAGGG - Intronic
978368595 4:108007946-108007968 CAACCCAATCTAAAAGTGCAAGG - Intronic
978666935 4:111195191-111195213 CAATCATAGCAGAAGGTGGAGGG - Intergenic
978993073 4:115111138-115111160 CAACTCAAACAGAAAGTACAAGG + Intronic
979531555 4:121774011-121774033 AAAGCCTAGCAGAAAGTGTAGGG - Intergenic
979709328 4:123759501-123759523 CAAAGCAAGCAGAAACTGAAAGG + Intergenic
980330777 4:131408598-131408620 GAACCAAACCAGAAAGGGGATGG + Intergenic
980375933 4:131949290-131949312 GAAGCCAAGAAGAAAGTGAAGGG - Intergenic
980562355 4:134493812-134493834 CAACAAAAGAAGAAAGTTGAAGG + Intergenic
982358597 4:154494524-154494546 CAATCATAGCAGAAAGTGAAGGG + Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
984921482 4:184768067-184768089 CAACACAAGCATAATGTGGGAGG - Intronic
987262580 5:16218685-16218707 CAACCGAAGCAGAAAGAAAAGGG + Intergenic
989769105 5:45121184-45121206 CAACCCAATCAAAAAGTGGGTGG + Intergenic
989953047 5:50323718-50323740 CAACCCCATCAAAAAGTGGGTGG + Intergenic
989958339 5:50380802-50380824 CAACCCCATCAAAAAGTGGGTGG + Intergenic
990280766 5:54248472-54248494 TAAGCCATGCAGACAGTGGAGGG - Intronic
990838132 5:60045187-60045209 CAACCCCATCAAAAAGTGGGTGG - Intronic
990877243 5:60499499-60499521 CAACCCAAGGAGAAAGCTGAGGG - Intronic
992909193 5:81378648-81378670 CAACCCCATCAAAAAGTGGGCGG + Intronic
993596753 5:89865876-89865898 CAACCAAATCAGAAAGAGGTGGG + Intergenic
994044085 5:95288543-95288565 CAACACAAGCAGAAAGTGAATGG + Intergenic
994607589 5:101988997-101989019 AAACTAAAGCAAAAAGTGGAAGG - Intergenic
995845521 5:116489665-116489687 AAAGCCAAGAAGAAAGGGGAAGG + Intronic
998211515 5:140202633-140202655 AAAGCCAAGAAGAAAGTTGATGG - Intronic
998228482 5:140344745-140344767 CAAGCCAATCAGAAAGGGGAGGG + Intronic
998480338 5:142457968-142457990 CAATCATGGCAGAAAGTGGAGGG - Intergenic
998568831 5:143239233-143239255 CAACCCTAGCAGGAAAGGGAGGG - Intergenic
999643258 5:153693131-153693153 AGACCCAAGTAGACAGTGGAGGG - Intronic
1000543166 5:162566148-162566170 CCACCCAGGCAGGAAGGGGAGGG + Intergenic
1000625092 5:163529348-163529370 CACCCTAAGTAGGAAGTGGATGG - Intergenic
1000797877 5:165688255-165688277 CAACCCCATCAAAAAGTGGGTGG - Intergenic
1001291650 5:170467396-170467418 CAACCCAATAAGAAAGTTGGAGG + Intronic
1001311576 5:170614751-170614773 CAACTCCAGCTGAAGGTGGATGG - Intronic
1003756654 6:9128511-9128533 CAATCCTAGCAGAAGGTGAAGGG - Intergenic
1003992415 6:11499201-11499223 CTCCCCCAGCAGGAAGTGGATGG - Intergenic
1004012446 6:11702654-11702676 CAAACGACGCAGAGAGTGGAGGG + Intergenic
1005378765 6:25212510-25212532 CAATCCCATCAAAAAGTGGATGG + Intergenic
1005680509 6:28202957-28202979 AAACCCAAGCAGTGAGTAGAGGG - Intergenic
1006109310 6:31735142-31735164 AAACCCAAGCAGAAGGGAGAGGG + Intronic
1006720901 6:36150129-36150151 CAGCCCAACCAAAAACTGGAGGG - Intergenic
1007859216 6:44889928-44889950 CAACCCCATCAAAAAGTGGGCGG + Intronic
1009528897 6:64784774-64784796 CAACACAAGCAATAAGTGAAGGG - Intronic
1009772358 6:68160164-68160186 CAATCACAGCAGAAAGTGAAAGG - Intergenic
1012427144 6:99127531-99127553 CAACCCAAGCAGTCAATGGTGGG + Intergenic
1013663379 6:112321964-112321986 CATCCCATGGAGAAAATGGATGG - Intergenic
1014036753 6:116775579-116775601 CAACCCCATCACAAAGTGGGCGG - Intergenic
1014070851 6:117180153-117180175 CAACCCCATCAAAAAGTGGGTGG + Intergenic
1014415463 6:121178020-121178042 CAATCATGGCAGAAAGTGGAAGG + Intronic
1014613344 6:123570839-123570861 GAAACCAAGCAGGAACTGGAGGG + Intronic
1015455875 6:133425534-133425556 CAAAACAGGAAGAAAGTGGAGGG - Intronic
1015597083 6:134875978-134876000 CAAACCAACCAGAAAGCAGACGG + Intergenic
1015854611 6:137610063-137610085 CAACCCAATCAGAATGTACAAGG - Intergenic
1015898167 6:138036770-138036792 CATCCCAAGCAGTAAATGGGTGG - Intergenic
1016401948 6:143690357-143690379 CAATGCAAGAGGAAAGTGGAAGG - Intronic
1017807539 6:157958695-157958717 AAACCAAAGCAGAAGGTGCATGG - Intergenic
1018604318 6:165580923-165580945 CAACCCAATGAGAAAGAAGATGG + Intronic
1020026043 7:4900800-4900822 CAACCCTAGCAGGAAGAGCAAGG - Intergenic
1020334159 7:7048893-7048915 CAATCACAGCAGAAAGTGAAGGG - Intergenic
1022142298 7:27503011-27503033 CAACCCCATCAAAAAGTGGGAGG - Intergenic
1022425439 7:30264559-30264581 CAACCCAACCAACAAGTGCATGG - Intergenic
1022659791 7:32356111-32356133 CAGCTCAATCAGAAAGTGGATGG + Intergenic
1024156020 7:46626364-46626386 CAACCCAAGGAGAGAGAGGATGG + Intergenic
1024699839 7:51895094-51895116 CAACCCCATCAAAAAGTGGGCGG + Intergenic
1024778447 7:52816586-52816608 TAACCCGAGCTGAGAGTGGATGG - Intergenic
1024998023 7:55289754-55289776 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1025847684 7:65215375-65215397 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1025897932 7:65721244-65721266 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1026644522 7:72156165-72156187 CAAACCAAGGAGAACCTGGAAGG + Intronic
1027545896 7:79527187-79527209 CAACCTCATCAAAAAGTGGAAGG - Intergenic
1027587545 7:80076642-80076664 AAACCCAAGCAGAGTGAGGAGGG + Intergenic
1027730693 7:81868814-81868836 CAGCCAAAGCAAAAAGTGTAAGG + Intergenic
1028720090 7:94020206-94020228 CAACCCCATCAAAAAGTGGGTGG + Intergenic
1029656443 7:101928265-101928287 CAACCCAGGCACCAAGTAGAAGG + Intronic
1031554837 7:123161520-123161542 CAAGGAAAGGAGAAAGTGGAAGG - Intronic
1032242760 7:130177626-130177648 CAATACAGGAAGAAAGTGGACGG + Intronic
1033594559 7:142848242-142848264 CAACCCAAGGAGAGACAGGAAGG - Intergenic
1034211354 7:149365782-149365804 AAAACCAAGTGGAAAGTGGAAGG - Intergenic
1034702001 7:153104616-153104638 CAACTTAATCAGAAAATGGAGGG - Intergenic
1034766294 7:153724658-153724680 GAACCCATGCAGAAAGCGAAGGG - Intergenic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035066120 7:156106151-156106173 CAAGCCAAGCTGAAAGGAGAGGG - Intergenic
1036044095 8:5120310-5120332 AATTCCAAACAGAAAGTGGAGGG + Intergenic
1037602124 8:20406099-20406121 CAAGCCAGGCAGATAGAGGAGGG - Intergenic
1038699603 8:29837233-29837255 GAAGCCAAGCAGAATGAGGAAGG + Intergenic
1039768545 8:40658888-40658910 AAAACCAGGCAGAAACTGGAGGG - Intronic
1040798161 8:51310730-51310752 CAAACCAAGCACAAAGTTAATGG + Intergenic
1042527210 8:69775639-69775661 GAACACAAACAGAAAATGGATGG + Intronic
1046959372 8:120094109-120094131 CAAGCCTAGGAAAAAGTGGAGGG - Intronic
1047667566 8:127108587-127108609 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1048506551 8:135027046-135027068 CAACACATGCATAGAGTGGAGGG - Intergenic
1050212475 9:3277435-3277457 AAGCCTATGCAGAAAGTGGATGG - Exonic
1051336071 9:16067287-16067309 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1052776083 9:32734199-32734221 CAACCCCATCAAAAAGTGGGCGG + Intergenic
1053206494 9:36190810-36190832 CTACCCAATCAGCAAGTGGAGGG - Intergenic
1053640982 9:40079957-40079979 GAAGCCAAGAAGAAAGTGAAGGG - Intergenic
1053678989 9:40467132-40467154 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1053928976 9:43095486-43095508 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1054284729 9:63157811-63157833 CAACCCCATCAAAAAGTGGGCGG + Intergenic
1054292069 9:63302670-63302692 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1054321671 9:63675938-63675960 GAAGCCAAGAAGAAAGTGAAGGG - Intergenic
1054390092 9:64607213-64607235 CAACCCCATCAAAAAGTGGGCGG - Intergenic
1054505629 9:65909163-65909185 CAACCCCATCAAAAAGTGGGCGG + Intergenic
1054543770 9:66296673-66296695 GAAGCCAAGAAGAAAGTGAAGGG + Intergenic
1055329379 9:75167623-75167645 CAACTCAAGGTGAAAGTGTAGGG + Intergenic
1055842399 9:80520415-80520437 CAATGAAAGCAGAAATTGGAGGG + Intergenic
1057841425 9:98488300-98488322 GAACCCCAGCAGAGAGAGGAGGG - Intronic
1059462936 9:114446567-114446589 AAACACATGCAGAAAGTAGAAGG - Intronic
1061799655 9:133106908-133106930 CAACCCAAGGAAAGAGTGTAAGG + Intronic
1202788752 9_KI270719v1_random:63032-63054 GAAGCCAAGAAGAAAGTGAAGGG - Intergenic
1186392299 X:9173198-9173220 GAATTCAAGGAGAAAGTGGATGG - Intergenic
1186944582 X:14551429-14551451 CATCCCAAGCAGAAAGCTGTTGG - Intronic
1186986333 X:15018275-15018297 TATCCAAAGCAGGAAGTGGAGGG + Intergenic
1189267628 X:39729134-39729156 CAAACAAAGCAGAAATTGCATGG + Intergenic
1191180143 X:57553337-57553359 CAACCCCAGCCAATAGTGGAAGG + Intergenic
1191977110 X:66885363-66885385 GAACCCTATCAGAAATTGGAAGG + Intergenic
1192341973 X:70270216-70270238 CAACAAAACCAGAAAGTGGCAGG + Intronic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1192676692 X:73203882-73203904 CAACCATGGCAGAAAGTGAAAGG + Intergenic
1194376653 X:93142888-93142910 CAATCATGGCAGAAAGTGGAGGG - Intergenic
1195832971 X:109080516-109080538 TAAAACAAGGAGAAAGTGGAAGG - Intergenic
1199023137 X:142905853-142905875 CAAACCAAGCACAAAGGGAAAGG - Intergenic
1199525619 X:148788542-148788564 CCACCCAAGCATAAAGAAGAGGG - Intronic
1201497807 Y:14608045-14608067 CAACCCCATCAAAAAGTGTAAGG - Intronic
1201966586 Y:19743235-19743257 CAATCCTAGAAGAAAGTGTAAGG + Exonic