ID: 953104288

View in Genome Browser
Species Human (GRCh38)
Location 3:39860759-39860781
Sequence ATTGATGTGGGGAGTGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953104288_953104295 26 Left 953104288 3:39860759-39860781 CCACGGCCACTCCCCACATCAAT 0: 1
1: 0
2: 4
3: 55
4: 226
Right 953104295 3:39860808-39860830 ACCTTGCCTTCCTTTCCCATTGG 0: 1
1: 0
2: 0
3: 29
4: 282
953104288_953104294 0 Left 953104288 3:39860759-39860781 CCACGGCCACTCCCCACATCAAT 0: 1
1: 0
2: 4
3: 55
4: 226
Right 953104294 3:39860782-39860804 TCACTAGTGTATGCACACATGGG 0: 1
1: 0
2: 0
3: 6
4: 97
953104288_953104293 -1 Left 953104288 3:39860759-39860781 CCACGGCCACTCCCCACATCAAT 0: 1
1: 0
2: 4
3: 55
4: 226
Right 953104293 3:39860781-39860803 TTCACTAGTGTATGCACACATGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953104288 Original CRISPR ATTGATGTGGGGAGTGGCCG TGG (reversed) Intronic