ID: 953104288 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:39860759-39860781 |
| Sequence | ATTGATGTGGGGAGTGGCCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 286 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 55, 4: 226} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953104288_953104295 | 26 | Left | 953104288 | 3:39860759-39860781 | CCACGGCCACTCCCCACATCAAT | 0: 1 1: 0 2: 4 3: 55 4: 226 |
||
| Right | 953104295 | 3:39860808-39860830 | ACCTTGCCTTCCTTTCCCATTGG | 0: 1 1: 0 2: 0 3: 29 4: 282 |
||||
| 953104288_953104294 | 0 | Left | 953104288 | 3:39860759-39860781 | CCACGGCCACTCCCCACATCAAT | 0: 1 1: 0 2: 4 3: 55 4: 226 |
||
| Right | 953104294 | 3:39860782-39860804 | TCACTAGTGTATGCACACATGGG | 0: 1 1: 0 2: 0 3: 6 4: 97 |
||||
| 953104288_953104293 | -1 | Left | 953104288 | 3:39860759-39860781 | CCACGGCCACTCCCCACATCAAT | 0: 1 1: 0 2: 4 3: 55 4: 226 |
||
| Right | 953104293 | 3:39860781-39860803 | TTCACTAGTGTATGCACACATGG | 0: 1 1: 0 2: 0 3: 8 4: 97 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953104288 | Original CRISPR | ATTGATGTGGGGAGTGGCCG TGG (reversed) | Intronic | ||