ID: 953107139

View in Genome Browser
Species Human (GRCh38)
Location 3:39894292-39894314
Sequence TCTGGAAGGCAGTGGCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953107139 Original CRISPR TCTGGAAGGCAGTGGCTAGA TGG (reversed) Intronic
900489929 1:2942778-2942800 CCTGGAAGCCAGTGGCTCCATGG - Intergenic
901475179 1:9484599-9484621 TTTGGGAGGCTGAGGCTAGAGGG + Intergenic
901491747 1:9600296-9600318 TCTGGTATGCAGTGGCTCCAGGG - Intronic
901776006 1:11560858-11560880 TCTGGAAGGTGGTGGCTGGGAGG + Intergenic
902300455 1:15498795-15498817 GCTGGAATGCAGTGGCGCGATGG + Intronic
902551458 1:17222109-17222131 TCTGGAAGCCAGGGCATAGATGG - Intronic
902863579 1:19262729-19262751 TCTGGGAGGTAGAGGCTACAGGG + Intergenic
902886348 1:19407614-19407636 TCTGGAAGGCTGAGGATTGAGGG + Intronic
903369901 1:22828473-22828495 TCTGGCAGGAAGAGGCCAGAGGG + Intronic
903888510 1:26554987-26555009 TCTGGTTGGCAGAGGCAAGAGGG + Intronic
904142846 1:28367583-28367605 TCTGGAAGGCCAAGGCTGGAGGG - Intergenic
904890454 1:33775696-33775718 TCTAGCAGGAAGTGGCTATATGG + Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905641159 1:39590951-39590973 TCAAGATGGCAGTGACTAGAGGG + Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
908780358 1:67685205-67685227 GCTGGTAGGCAGTGGCTGGGAGG + Exonic
911510972 1:98807174-98807196 TCTTGAAGACAGTGGACAGATGG - Intergenic
911607729 1:99927577-99927599 TTTGGGAGGCTGAGGCTAGAGGG - Intergenic
912895446 1:113582710-113582732 TCAGGGAGGGAGTGGCTATAGGG + Intronic
913606502 1:120472100-120472122 TTTGGAAGGCTGTGGCAGGAGGG - Intergenic
913988772 1:143589312-143589334 TTTGGAAGGCTGTGGCAGGATGG + Intergenic
914209927 1:145568039-145568061 TTTGGAAGGCTGTGGCAAGAGGG + Intergenic
914268850 1:146060416-146060438 TTTGGAAGGCTGTGGCAGGAGGG + Intergenic
914368245 1:147000453-147000475 TTTGGAAGGCTGTGGCAGGAGGG - Intergenic
914584693 1:149049739-149049761 TTTGGAAGGCTGTGGCAGGAGGG + Intergenic
915114904 1:153591265-153591287 GCTGGAATGCAGTGGCGTGATGG - Intergenic
915270511 1:154750251-154750273 TCTGGAGAGCAGCGGCTGGAAGG + Intronic
915601253 1:156924402-156924424 TCTGGAAGGCAGAGGTGAGGAGG - Exonic
915934152 1:160081075-160081097 TCCAGAAGGCGGTAGCTAGAAGG - Intergenic
916945240 1:169719703-169719725 TCTGGAAGGTAAAGGCAAGATGG - Intronic
917991517 1:180384956-180384978 TCATGAAGGTAGTGGGTAGAAGG + Intronic
918082823 1:181220844-181220866 GCTGGTAGGCAGGGGCCAGAGGG - Intergenic
919598629 1:199595160-199595182 TCCTGAAGGCAGTGGATAGTTGG - Intergenic
922425028 1:225484579-225484601 GCTGGGAGGGAGTGGCTGGAAGG + Intergenic
923048116 1:230370167-230370189 TCTTGACTGCAGTGGCTGGAGGG - Intronic
923172328 1:231429255-231429277 TCTGGAGGACAGTGGCTGGTTGG + Intergenic
923981657 1:239330871-239330893 GCTGAAAAGCAGTGGCAAGAGGG - Intergenic
924738886 1:246783081-246783103 TCTGGAAGGCTGTGGCCTGGGGG - Intergenic
1063041792 10:2348125-2348147 TCTGGAAGCCATTGGCAAGGTGG - Intergenic
1063672356 10:8109529-8109551 TCTGGAAGGCTCTGGCTGGCTGG - Intergenic
1064375177 10:14788989-14789011 TTAGGAAGGCAGTGAATAGAAGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1067053045 10:43036052-43036074 TCTTGATGGCAGTGGTTACACGG + Intergenic
1067199546 10:44155550-44155572 TCTGAAAGATAGTGGATAGAAGG + Intergenic
1067227307 10:44384580-44384602 GCGGGAAGGCAGTGGGTGGAGGG + Intronic
1067288701 10:44926265-44926287 GCTGGAAAGCAGTGGGTAGCAGG + Intronic
1067775476 10:49161910-49161932 GCTGGGAGGCAATGGCTGGATGG - Intronic
1068379895 10:56238489-56238511 TCAGGAAAGGAGTGGCTGGAAGG + Intergenic
1069807064 10:71132693-71132715 TGTGGCAGGAAGTGGCTGGAGGG - Intergenic
1073001694 10:100290524-100290546 TCAGGAAGTCAGAGGTTAGAGGG + Intronic
1073059793 10:100726544-100726566 TCTGGAAGGCAGGGGGTGGGGGG + Intergenic
1073581972 10:104676885-104676907 TCTGGATGGAAGTGGAGAGAAGG - Intronic
1073900283 10:108213326-108213348 TCTTGAAGGCAGTAGATAGCTGG + Intergenic
1074116114 10:110458586-110458608 TCTGGAGGGCGGTGGTTACAGGG + Intergenic
1076098449 10:127753602-127753624 ACTGGAGGGAAGGGGCTAGAAGG + Intergenic
1076788383 10:132763092-132763114 TCAGGAAGGCACTGGCAGGAGGG - Intronic
1077064741 11:636172-636194 TCTGGAGGACACGGGCTAGACGG - Intergenic
1078557330 11:12340051-12340073 TCTGGAAGGTAGAGCCAAGATGG - Intronic
1079043790 11:17082049-17082071 TTTGGAAGGCTGAGGCTGGAGGG - Intronic
1080875205 11:36268609-36268631 TCTGGAAGCCATTGGCTACCTGG - Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1084149958 11:67283416-67283438 TCTGGAAGCCAGTTACTAGCTGG - Intronic
1085689358 11:78652880-78652902 TGTGGAAGGCAGTGGCATGGTGG + Exonic
1085705994 11:78787124-78787146 GATGGGAGGCAGTGGCCAGAGGG + Intronic
1086042185 11:82492950-82492972 TCTTGAAGACAGTAGATAGATGG + Intergenic
1087116718 11:94533353-94533375 TCTAGCAGGCAGTAGCTAAATGG - Intergenic
1087785840 11:102353375-102353397 GCTGGAGTGCAGTGGCAAGATGG + Intronic
1090790343 11:130087767-130087789 TCTAATAGGAAGTGGCTAGACGG - Intronic
1091375340 12:21567-21589 TCTGGAAGGCTGTGTCGGGAAGG + Intergenic
1091457567 12:619099-619121 TGAGGAGAGCAGTGGCTAGAAGG + Intronic
1091845816 12:3655696-3655718 TCTGCAGGGCAGTGTCTATATGG - Intronic
1092373751 12:7938380-7938402 CCTGGAAGGCAATGGTGAGATGG - Intergenic
1092816938 12:12320603-12320625 TCTGGAAGGCAGGGGCTGCTGGG + Intergenic
1092987775 12:13863195-13863217 CCTGGAAGGCAGTAGCCAGTGGG + Intronic
1093139960 12:15497977-15497999 TCTGGGTGGAAGGGGCTAGAGGG + Intronic
1094014274 12:25845996-25846018 GCTGGAATGCAGTGGCACGATGG + Intergenic
1095743407 12:45631567-45631589 TGTGGGAGGTAGTGGCAAGAGGG - Intergenic
1096183443 12:49563851-49563873 GGTGGTAGGCAGTGGCTAGGGGG - Intronic
1096416623 12:51420090-51420112 TGTGGAAGGGAGGGGCGAGAGGG - Intronic
1096550379 12:52368198-52368220 AATGGAAGAAAGTGGCTAGAGGG - Intergenic
1096724299 12:53548738-53548760 TTTGGAAGGCTGAGGCAAGAGGG + Intronic
1097011318 12:55955416-55955438 TGAGGAAGGGAGTGGATAGAGGG - Intronic
1097308361 12:58093437-58093459 TTTGGGAGGCAGTGGGGAGATGG + Intergenic
1097360817 12:58656280-58656302 TCAGGCAGTCAGTGGCTTGAAGG + Intronic
1101807288 12:108075475-108075497 GCTGGAGTGCAGTGGCGAGAGGG + Intergenic
1101824750 12:108211307-108211329 TCTGGGAAGCACTGGCCAGAGGG - Intronic
1101856288 12:108446112-108446134 TCTGGGAGGCAGAGGTTACACGG - Intergenic
1102477510 12:113198266-113198288 ACTGGAAGGGAGTGGCGAGGAGG + Intronic
1104614965 12:130259808-130259830 TCTGGATGGCGGTGCCTGGAGGG - Intergenic
1108046543 13:46388808-46388830 TCTGGCATGGAGTGGCTAAACGG + Intronic
1108503404 13:51087898-51087920 CCAGGAAGGCAGTGGGAAGATGG - Intergenic
1108505111 13:51106219-51106241 GCTGAAAGGAAGTGGCCAGAAGG - Intergenic
1109974231 13:69809781-69809803 TCTGGAAGACAGTGGAAGGATGG - Intronic
1110024413 13:70516825-70516847 TTTGGAATGTAGTGACTAGATGG + Intergenic
1110155451 13:72311317-72311339 TCTGTTAGGCAGTTGCTGGAGGG + Intergenic
1111642650 13:90989344-90989366 TCTGGAAGGCAATTTTTAGATGG + Intergenic
1112735605 13:102413149-102413171 GCTGGAGAACAGTGGCTAGAAGG - Intergenic
1112802195 13:103124745-103124767 GGTGGGAGGCAGTGGGTAGAAGG + Intergenic
1112905499 13:104414957-104414979 TCTGGAATGCACTCTCTAGAAGG + Intergenic
1113449124 13:110393801-110393823 TCTGGGAGGCAGAGGTTACAGGG + Intronic
1113935702 13:113994552-113994574 TCTGGGAGGCCGAGGCAAGAAGG + Intronic
1114290816 14:21286916-21286938 TTTGGGAGGCAGAGGCTGGAAGG + Intergenic
1115508878 14:34120304-34120326 TCTGGCACGCAATGACTAGAGGG + Intronic
1116117984 14:40681867-40681889 TCTTGAAGGCAGTGGATATTTGG + Intergenic
1116649918 14:47576991-47577013 TTTGGGAGGCAGAGGCAAGAGGG - Intronic
1116721572 14:48503293-48503315 TCTGCAAGCCAGTGGCTGAAGGG + Intergenic
1117605581 14:57425218-57425240 ACTGTAAGCCAGAGGCTAGAAGG + Intergenic
1117776658 14:59190104-59190126 GCTGGGAGGGAGTGGCTAGTGGG + Intronic
1119073253 14:71608842-71608864 GCTGGAATGCAGTGGCACGATGG - Intronic
1119609036 14:76046256-76046278 TGTGGAAAGCAGTGGCCAGCTGG + Intronic
1119860318 14:77931428-77931450 TCTGGCAGGCTGTGACCAGAGGG - Intronic
1122146660 14:99693093-99693115 TGTGCCAGGCAGGGGCTAGATGG - Intronic
1122251757 14:100444711-100444733 TCTGGAGGGCTGTGTCTAGAAGG + Intronic
1124371862 15:29108557-29108579 TCTGGGAGGTCCTGGCTAGAAGG + Intronic
1126054170 15:44713898-44713920 TCTGGGAGGCTGTGGGGAGAAGG - Intronic
1126890963 15:53203746-53203768 TCTGGAGGTCAGAGGCCAGAGGG - Intergenic
1127824648 15:62692261-62692283 TCTTTAAGCCACTGGCTAGAGGG + Intronic
1127869940 15:63063556-63063578 TCAGGAAGTCAGTGGTTTGAAGG + Intronic
1128187632 15:65656684-65656706 ATTGGAAGTCAGTGGCTACATGG + Intronic
1129608570 15:77036664-77036686 CTTGGATGGCAGTGGCTAGCTGG + Intronic
1129878521 15:78992543-78992565 GCTGGAAGGCGGTGGGTAAAGGG + Intronic
1131077761 15:89506544-89506566 GCTGGAAGGCAGTTGACAGAAGG - Intergenic
1132652210 16:1026627-1026649 TCTGCAAGGCAGTGGTAAGGGGG + Intergenic
1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG + Intronic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137584108 16:49653768-49653790 TCCGGGAGGCAGTGTCTTGAAGG - Intronic
1137654165 16:50146006-50146028 GCTGGAATGCAGTGGCATGATGG - Intergenic
1138355656 16:56377578-56377600 ATTGGAAAGCAGTGGTTAGATGG - Intronic
1139004469 16:62553563-62553585 TAAGGAAGGCAGTGTGTAGAGGG + Intergenic
1139100329 16:63759173-63759195 TCAGGAAGGCTTTGGCTATATGG - Intergenic
1139315961 16:66069032-66069054 TCTGGAAGGGAATTGCTTGAAGG - Intergenic
1141164886 16:81653661-81653683 TCTGGAGTGCAGTGGCGTGACGG + Intronic
1141328232 16:83082594-83082616 GCTGGAATGCAGTGGCACGATGG - Intronic
1146004396 17:29151714-29151736 TCTGGAATGCAGTGGCCTGAGGG + Intronic
1146052060 17:29562206-29562228 TCTTACTGGCAGTGGCTAGAGGG - Exonic
1146137526 17:30336020-30336042 TCAGGAAGTCACTGGCTATATGG + Intergenic
1146183347 17:30710331-30710353 TCTGGGAGGCAGTGGCGCGGGGG + Intergenic
1147449239 17:40493650-40493672 TAAGGCAGGCAGTGGCCAGAGGG - Intronic
1147599939 17:41739288-41739310 TTTGGGAGGCCGAGGCTAGATGG - Intergenic
1147619638 17:41856942-41856964 TCTGGGAGGCAGAGGTTATAGGG + Intronic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148760571 17:49997769-49997791 TCTGGAAGGCAGTGGTGAAGTGG - Intergenic
1150274912 17:63890579-63890601 GCTGGAGGGCAGTGGCATGATGG + Intergenic
1150277043 17:63905345-63905367 GCTGGAGTGCAGTGGCTTGATGG + Intergenic
1151181184 17:72329799-72329821 TCTGGAACACAGTGGCCAGAAGG - Intergenic
1152367521 17:79865164-79865186 TCTGGAAGGCTGTGACTTGGTGG - Intergenic
1152492294 17:80644932-80644954 TTTAGAAGGCAGTGGCTTCATGG + Intronic
1154005184 18:10521277-10521299 TCTGGGAGGCTGAGGCAAGAGGG + Intergenic
1154266159 18:12881011-12881033 TCTGTTAGGCAGTGGCAGGAGGG - Intronic
1155098482 18:22584174-22584196 TCTGGGAGGCAGGGGCCTGATGG - Intergenic
1155913563 18:31533426-31533448 TCTGGAATGCAGTGGTGTGATGG - Intronic
1156302899 18:35850736-35850758 TTGGGCAGGCAGTTGCTAGACGG + Intergenic
1156464714 18:37341501-37341523 ACTGGAAGGCAGTGAGTGGAGGG + Intronic
1159081419 18:63739980-63740002 TCTGGAAGACACAGGCTATAAGG - Intergenic
1159266256 18:66083859-66083881 TCTGGGAGGCAGAGGTCAGAAGG - Intergenic
1160272735 18:77402731-77402753 TCTGGATGGCAGAGTCTATATGG + Intergenic
1160383870 18:78482059-78482081 TCTGGGAGGCTGCGGCTGGAGGG + Intergenic
1160977470 19:1800449-1800471 TCTGGAAGGCAGACGCGACAGGG + Exonic
1162525917 19:11206310-11206332 TTTGGAAGGCCGAGGCGAGAGGG + Intronic
1162975443 19:14205429-14205451 TCTGGGAGGCAGTGGCGCGGGGG - Intronic
1163616490 19:18331978-18332000 GCTGGAGTGCAGTGGCAAGATGG + Intergenic
1164278714 19:23749012-23749034 TCTGCAATGCAGGAGCTAGAAGG + Intronic
1164771590 19:30813739-30813761 ACTGGGAGGCAGTGGCAAGAGGG + Intergenic
1202708392 1_KI270714v1_random:1833-1855 TTTGGAAGGCTGTGGCAGGAGGG - Intergenic
924985549 2:265843-265865 TCTGGAAGGCAGTGTCCCGAGGG - Intronic
925766600 2:7242384-7242406 TCTGGGGGGCAGTGGAGAGAAGG + Intergenic
926313071 2:11688444-11688466 TCTGCATGGCAGTGGCTGGGAGG + Intronic
926549972 2:14289238-14289260 TCTAGAAGGAAGTGGCATGAGGG - Intergenic
927330092 2:21852327-21852349 TCTGGATGGAAGGTGCTAGAAGG + Intergenic
927423789 2:22958822-22958844 TCTGGAAGGAAGGTGTTAGATGG - Intergenic
927477657 2:23426131-23426153 TCTGGAAGGCTGTGGGAAGCGGG + Intronic
929620618 2:43350529-43350551 TGTGGAAGTCAGAGGCAAGAGGG - Intronic
929736430 2:44555029-44555051 TATGGAAGGCCTTGGCAAGAGGG + Intronic
929763611 2:44826205-44826227 TCTGGAGGGCAGAAGGTAGAAGG - Intergenic
930180266 2:48349120-48349142 GCTGGAATGCAGTGGTGAGATGG - Intronic
930530127 2:52579725-52579747 TCTGGAAGGCAGTAGCCAAGTGG + Intergenic
930610658 2:53539399-53539421 ATTGGAAGGCAGTGAATAGATGG - Intronic
930723981 2:54664894-54664916 TTTGGATGGGAGTAGCTAGAAGG + Intronic
930865988 2:56122207-56122229 CCTTGAAGGCACTGGCTAGCGGG + Intergenic
932438162 2:71715431-71715453 TCTGGGTGGCAGGGGCCAGAGGG - Intergenic
933005555 2:76988853-76988875 TCTGGGAGGCAGTGGTATGAGGG + Intronic
933507212 2:83192687-83192709 TTTGGAAGGCTGAGGCTAGGAGG - Intergenic
937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG + Intergenic
937847575 2:126598542-126598564 TCCGGTAGGTAGTGCCTAGATGG - Intergenic
938566132 2:132520694-132520716 TTTTGAAGGGAGTGGGTAGAGGG + Intronic
941227730 2:162869061-162869083 TCTGGAAGTCAGGGACTAGAGGG - Intergenic
943032365 2:182700839-182700861 TCTGGAAGGCAGAGGTTGCAAGG + Intergenic
945068407 2:205966722-205966744 TCTGGAGGGGAGAGGCTGGAGGG + Intergenic
945151893 2:206800569-206800591 TGTGGATGGCAGTGGCGAGGGGG + Intergenic
945197838 2:207253846-207253868 TCTGTAAGGCAGGGACTGGAGGG + Intergenic
946150957 2:217770178-217770200 TCTGGAAGTCAGAGTCTAAATGG + Intergenic
946429772 2:219619092-219619114 CCTGGAAAGCAGTGGAGAGAAGG + Intergenic
947634520 2:231673308-231673330 TCTGGGAGGCCGGGTCTAGAAGG + Intergenic
947724006 2:232386461-232386483 TCTGGCAGGCAGTGGGGAGCGGG - Intergenic
948298630 2:236885120-236885142 GCTGGAGGGCAGTGTCAAGATGG + Intergenic
948404114 2:237704707-237704729 TCTAGAAGGCAGGGGCTGCAAGG + Intronic
948572062 2:238923889-238923911 TCTGGGGGGCGGTGGATAGAGGG + Intergenic
1168978596 20:1986471-1986493 TCTGGAAGCCAGTGGACACAGGG - Intronic
1169213216 20:3778957-3778979 CCAGGATGGCAGTGGCTACATGG - Exonic
1169427862 20:5510303-5510325 CGAGGGAGGCAGTGGCTAGAAGG - Intergenic
1169651503 20:7873353-7873375 TCTGGAGGGGAGTGGTTAAAAGG - Intergenic
1170363852 20:15578644-15578666 TCCAGAGGGCAGTGGCTAGAAGG + Intronic
1170582873 20:17712026-17712048 TCTTCAAGGCAGTGGGGAGAGGG + Intronic
1171145047 20:22774352-22774374 CCAGGAAGGCAGTGGCTCGGAGG - Intergenic
1172034104 20:31999849-31999871 TCTAGAAGGCAGCAGCCAGATGG - Exonic
1172855946 20:38002552-38002574 CCTGGTTGGCAGTGGCTACACGG - Intronic
1172956147 20:38760772-38760794 ATTGAAAGGCAGTGGGTAGATGG + Intronic
1173580729 20:44144826-44144848 GCTGGCAGGCAGTGGTGAGAAGG + Intronic
1174276453 20:49407956-49407978 CCTGGAAAGCGGAGGCTAGAGGG - Intronic
1174376597 20:50130163-50130185 TCAGGCAGTCACTGGCTAGAGGG - Intronic
1174906543 20:54557806-54557828 TGTGGAAGGCAGTGAGTAGGTGG - Intronic
1175152798 20:56948318-56948340 TCTGGAAGGTCGTGTCTGGAAGG + Intergenic
1175995470 20:62810360-62810382 TCTAGGAGGGAGTGGCTAGGTGG - Intronic
1176002052 20:62836610-62836632 GCTGGAAAGCAGTGGCACGAAGG - Intronic
1176235770 20:64052803-64052825 TCTGGAGGACAGTGGCTGGGAGG - Intronic
1178685761 21:34709461-34709483 TCTGGAAGGAAGTTTCTGGATGG + Exonic
1178907617 21:36649667-36649689 TGTGGAAGGCAATGGGTGGAGGG - Intergenic
1179128632 21:38614522-38614544 GTTGGCAGGCAGTGGCTAGAAGG + Intronic
1179128649 21:38614614-38614636 GGTGGCAGGCAGTGGCTAGAAGG + Intronic
1180788630 22:18561171-18561193 GCTGGAGTGCAGTGGCGAGATGG + Intergenic
1181129828 22:20724530-20724552 TCTGGGAGGCAGAGGCTGCAAGG + Intronic
1181233108 22:21434147-21434169 GCTGGAGTGCAGTGGCGAGATGG - Intronic
1181245543 22:21500696-21500718 GCTGGAGTGCAGTGGCGAGATGG + Intergenic
1182604183 22:31490199-31490221 TCCCGGAGGCGGTGGCTAGATGG + Intronic
1183264782 22:36818463-36818485 TCTGGCGGGCTGTGGCTTGAAGG - Intronic
1183378718 22:37480081-37480103 TCTAGCAGGCAGTGGGCAGATGG - Intronic
1184196453 22:42932428-42932450 TCTGGAATTCACTGTCTAGAGGG - Intronic
1184353217 22:43958867-43958889 TCTGAAAGACACTGGCTAGTGGG - Intronic
1185278281 22:49959214-49959236 TCTGGGAAGCAGCGGCTGGAGGG + Intergenic
1185318139 22:50187591-50187613 TCTGGGAGGCAGTTTCTAGTGGG + Intronic
949459113 3:4271547-4271569 GCTGGAATGCAGTGGCGTGATGG + Intronic
949920855 3:8999433-8999455 TCTGGAATGGCATGGCTAGAGGG - Intronic
953107139 3:39894292-39894314 TCTGGAAGGCAGTGGCTAGATGG - Intronic
953334202 3:42080007-42080029 GCTGGAAGGCAGTGTGTTGAAGG + Intronic
953556101 3:43948120-43948142 TTTCGAAGGCATTGGGTAGAGGG + Intergenic
954907630 3:54076397-54076419 TATGCAAGGCAGAGGCAAGAGGG - Intergenic
955880535 3:63539877-63539899 GGTGGAAGTCAGTGGGTAGATGG - Intronic
957076347 3:75605973-75605995 CCTGGAGGGCTGTGGGTAGAAGG - Intergenic
958947238 3:100377436-100377458 TATGGTAGGCAGTGGCTACAGGG + Intronic
959505658 3:107153708-107153730 TCTGGAGGACAGTGGAGAGAAGG - Intergenic
960121884 3:113955466-113955488 CCTGGCATGCAGTGGGTAGAAGG + Intronic
960457534 3:117891474-117891496 TCTGGAAGGTAATGTCTATAAGG - Intergenic
960732490 3:120742504-120742526 CAGGGAAGGCAGTGGCAAGATGG - Exonic
960928401 3:122819194-122819216 GCTGGAATGCAGTGGCACGAAGG - Intronic
961105007 3:124233343-124233365 TGTGGAAGGCAATGGAGAGATGG + Intronic
962342513 3:134597212-134597234 CCTGGATGGCAGGGGCAAGAGGG + Intergenic
963546812 3:146670265-146670287 TCTTGAAGACAGTAGATAGATGG + Intergenic
963924162 3:150933833-150933855 TATGCAGGGCAGTGGCTAAAGGG - Intronic
964175219 3:153819944-153819966 TCTGGAAGACATTGGCAAGCAGG + Intergenic
965899227 3:173618241-173618263 GCTGGAATGCAGTTGCAAGATGG + Intronic
966315253 3:178637464-178637486 ACTGGAAGGGAGTGGTGAGAAGG + Intronic
966459885 3:180165284-180165306 CCAGGAAGGCAGGGGTTAGATGG + Intergenic
966740148 3:183225037-183225059 TCTGCAAGGAGGTGGCTACATGG - Intronic
967881311 3:194303761-194303783 TCTGAGAGGCAGTGGCCAGAAGG + Intergenic
968539236 4:1154798-1154820 TCTGGAAAGAAGTGGGAAGATGG + Intergenic
968754250 4:2407090-2407112 TCGGGGAGGGAGTGGGTAGATGG - Intronic
969521044 4:7677928-7677950 TCCGGAAGGCAGTGGGTGGGTGG + Intronic
972023778 4:34350979-34351001 TATGAGGGGCAGTGGCTAGATGG + Intergenic
973562395 4:52150144-52150166 TCAGGAAAGCAGAAGCTAGAGGG + Intergenic
976431497 4:84966923-84966945 TCTGGAAGGCAGTGGGGAGAGGG - Intergenic
976949875 4:90814689-90814711 TCTGTAGGGCAGTGGCAAAATGG + Intronic
977095264 4:92734524-92734546 TTTGGAAGCCTGTGGCTGGAGGG - Intronic
978504631 4:109443482-109443504 TCTGGGAGGCAGAGGTTGGAGGG - Intronic
979131254 4:117048343-117048365 TCAGGAAGGCACTGGCTTAAGGG - Intergenic
980821970 4:138029134-138029156 TCAGGAAAGCACTGGATAGAAGG - Intergenic
983279351 4:165660671-165660693 TATGCAAAGCAATGGCTAGAAGG - Intergenic
986045207 5:4030211-4030233 GCTGGAAGCCAGTGGCAAGAAGG - Intergenic
986762475 5:10892956-10892978 ACTGGCAGGCATTGGCAAGAAGG - Intergenic
986875041 5:12097089-12097111 TCTAGAAGTGAGTGGCTAGGGGG + Intergenic
990181817 5:53169171-53169193 TCTCAAAGGAAGTTGCTAGAGGG - Intergenic
990753246 5:59039981-59040003 CCTGGAGGGCAGTGGCTCGGCGG - Intronic
991410117 5:66337428-66337450 GCTGGAAGGCAGTGCCTTGTGGG - Intergenic
995732602 5:115262512-115262534 TCTGGAAGGCTGTAGGTCGAGGG - Intronic
996032160 5:118717460-118717482 TCTCGAAGGCAGCAGCTAGTTGG - Intergenic
996854138 5:127986172-127986194 TTTGGAAGGCAGAGGCTGGTGGG - Intergenic
997414011 5:133711287-133711309 TGTGTGAGGCAGAGGCTAGATGG + Intergenic
998513707 5:142734701-142734723 TCAGGGAGGCAGTGTCTACAGGG - Intergenic
999670704 5:153956968-153956990 TCGGGAAGGCAGAGACAAGAGGG - Intergenic
1001450892 5:171823472-171823494 TCTAGAAGGCAGAGGCTGTAAGG - Intergenic
1002088793 5:176792635-176792657 GCTGGAAGGCAGGGGCAACAGGG + Intergenic
1002117355 5:176973395-176973417 TGGGGATGGCAGTGGTTAGAGGG + Intronic
1002586639 5:180252882-180252904 TCTGGAAGACAGAGGTTAGTGGG - Intronic
1004037603 6:11938861-11938883 TCTGTAAGGCAGGGGGTAGATGG + Intergenic
1004077947 6:12362452-12362474 TGTGGAAGGGAGTGGCAGGATGG + Intergenic
1004349831 6:14881292-14881314 ACTGGAAGTCTGTGTCTAGAGGG - Intergenic
1004778511 6:18876877-18876899 TGTGGAAAGCAGTGTCTAAAGGG - Intergenic
1006919792 6:37619871-37619893 GCTGGGAGGCAGTGGGTAGCGGG - Intergenic
1007459080 6:42003889-42003911 GCTGGAATGCAGTGGCATGATGG - Intronic
1007849859 6:44792671-44792693 GCTGGAGTGCAGTGGCGAGATGG + Intergenic
1007877209 6:45118650-45118672 TTTGGAAGGCATTGGCTGAATGG - Intronic
1008131081 6:47720611-47720633 TCTGGGAGGCAGGGGAGAGAGGG + Intronic
1008875276 6:56319263-56319285 TCTGGTAGGCAGAGTCAAGAGGG + Intronic
1011275145 6:85623486-85623508 TCTGGGAGGCAGAGGCTGCAGGG + Intronic
1011994601 6:93569254-93569276 GCTGAAGGGCAATGGCTAGAGGG + Intergenic
1012448955 6:99334841-99334863 GCAGGTGGGCAGTGGCTAGATGG - Intronic
1014887220 6:126796544-126796566 GATGGAAGGAAGTGGCTGGAAGG - Intergenic
1015004997 6:128269193-128269215 TGTGCAAGGCAGTGTATAGAAGG + Intronic
1016810242 6:148253794-148253816 TCTGGAAGGCAGAGGATGCAGGG + Intergenic
1017920643 6:158869503-158869525 TCTGGGAGGGAGTTGCCAGATGG - Intergenic
1018153484 6:160963000-160963022 TCTGGAAGCCAGTTGTTAAAAGG - Intergenic
1021616049 7:22504298-22504320 TCTGGAAGGAACTGGCTCCAGGG + Intronic
1021909072 7:25366083-25366105 TCAGGAAGACACTGGCTAGGTGG + Intergenic
1022925842 7:35055501-35055523 TCTGGAAGGAACTGGCTCCAGGG + Intergenic
1023697001 7:42857667-42857689 TCTGGGAGGATGTGGCCAGAAGG - Intergenic
1025794604 7:64727562-64727584 TCTTGAAGGCAGTAGATAGTTGG + Intergenic
1026108339 7:67438475-67438497 TCTGGGAGGCAGTGAGTACAAGG + Intergenic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1027423059 7:78035654-78035676 AGTGGAAGCCAGTGGCCAGATGG - Intronic
1028933781 7:96443049-96443071 CCTGGAAGGCAGTGGTTGCAAGG + Intergenic
1029410925 7:100410141-100410163 TCTGGAAGGTAATGGATAAAAGG - Intronic
1029823848 7:103170194-103170216 TCTGGAAGGAACTGGCTCCAGGG + Intergenic
1029923200 7:104287851-104287873 TTTGGAAGGCTGAGGCTGGAGGG - Intergenic
1030080559 7:105774218-105774240 TTAAGAAGGCAGGGGCTAGATGG - Intronic
1030390258 7:108919249-108919271 TCTGGAAGGCAGTAGATTGTTGG + Intergenic
1030598924 7:111570948-111570970 CCAGGATGGCAGTGGCTATAGGG + Intergenic
1033177292 7:139136495-139136517 CCTGGAATGCAGTGGCGTGATGG + Intronic
1033690984 7:143736867-143736889 TCTGGGAGGCCGAGGCTAGGTGG - Intergenic
1034191525 7:149217000-149217022 TCTGGAGTGCAGTGGCTAAAAGG + Intronic
1034683001 7:152945225-152945247 TCTTGAAGGCAGTGGATGGTTGG + Intergenic
1038600213 8:28933161-28933183 TATGAATTGCAGTGGCTAGAGGG - Intronic
1040290365 8:46121111-46121133 TCAGGAAGGCAGAGGGGAGAAGG - Intergenic
1040363356 8:46688882-46688904 TTTGGAAGGCTGAGGCTAGGAGG - Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1041475589 8:58261574-58261596 CCTGGAAGGCAATGTATAGATGG + Intergenic
1041478695 8:58294567-58294589 TCTAGAAGGCTGAGGCAAGAGGG - Intergenic
1042014525 8:64293336-64293358 TCTGAGAGGCAGTGGGAAGAAGG - Intergenic
1042096778 8:65224831-65224853 CCTAGAAGGCAGTTGCTACATGG + Intergenic
1042184443 8:66122725-66122747 TCTAAAAGGAAGAGGCTAGAAGG - Intergenic
1043388629 8:79770127-79770149 TCTGGAAGGCAGAGGGGAGCAGG - Intergenic
1043728708 8:83647335-83647357 TCTGGAAAGCAGGGACTGGAGGG - Intergenic
1044634574 8:94309756-94309778 TCTGGAAGGCTATGGGGAGAGGG + Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047773508 8:128049654-128049676 TTTGGAAGGCACTGGCAGGATGG + Intergenic
1048221038 8:132542134-132542156 TTTGGAAGGCAGAGGCGGGAAGG + Intergenic
1049015893 8:139919809-139919831 ACAGGAAGGCAGTGGCTTGAGGG + Intronic
1049741410 8:144242806-144242828 CCTGGACGGCAGTGGGAAGAAGG + Intronic
1051209279 9:14724511-14724533 TTTGGGAGGCAGAGGCAAGATGG - Intergenic
1051454903 9:17244458-17244480 TTTGGAAGGCAGAGGCAGGAGGG - Intronic
1051820628 9:21162424-21162446 TCTAGAAGCCAATGTCTAGAAGG - Intergenic
1052624718 9:30960617-30960639 TCTGGAAGGCAGCAGATAGTTGG + Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1055676827 9:78671753-78671775 ACTGGAGGATAGTGGCTAGAGGG + Intergenic
1056322534 9:85450295-85450317 TCTTGAAGGCAGTAGATAGTTGG + Intergenic
1057943339 9:99303953-99303975 CGTGGGAGACAGTGGCTAGATGG + Intergenic
1059767383 9:117396277-117396299 TCTGGCAGTCAGTGGAAAGAAGG - Intronic
1060890511 9:127185029-127185051 TCTGGAGGCCACTGGGTAGATGG - Intronic
1060993821 9:127864351-127864373 TTTGGAAGGCAGAGGCGGGAGGG + Intergenic
1061498355 9:130988685-130988707 TCTCGATGGCAGTGGGCAGAAGG + Intergenic
1061634714 9:131900173-131900195 TCTGGGAGGCGATGGCCAGATGG - Intronic
1062427979 9:136514799-136514821 CCTGGAAGGATGTGGCCAGAAGG - Intronic
1185642146 X:1594261-1594283 GCTGGAAGGAAGTCGCCAGAGGG - Intronic
1190061583 X:47215064-47215086 GGTAGAAGGCAGTGGCAAGAGGG - Exonic
1191696773 X:63998052-63998074 GCTGGAATGCAGTGGCATGATGG + Intergenic
1192129412 X:68534627-68534649 TCTGAAAGTGAGTGGCTTGAAGG + Exonic
1192208156 X:69109689-69109711 TCTGGGAGGCAGTGGCATGTGGG + Intergenic
1193405074 X:81090835-81090857 TCTTGAAGGCAGCAGATAGATGG - Intergenic
1194700072 X:97103286-97103308 CCTGGAAAGGAGTGGATAGATGG + Intronic
1198252134 X:134890025-134890047 GCTGGAGGGCAGTGGCTGGCTGG - Intronic
1201368818 Y:13238106-13238128 CCTGGAAAGCAGGGGTTAGAGGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic