ID: 953107369

View in Genome Browser
Species Human (GRCh38)
Location 3:39897071-39897093
Sequence AATCAATTCAGTAATTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953107369 Original CRISPR AATCAATTCAGTAATTATGT TGG Intronic
901189240 1:7395916-7395938 AATGAATTCAGTAAAGTTGTAGG - Intronic
901342068 1:8503917-8503939 AAGCAAATAAGTAATTTTGTTGG + Intronic
902583005 1:17420936-17420958 AATAAACTCAGTAATTCTGAAGG + Intronic
903194377 1:21673853-21673875 GATCAATACAGTAATTATGTTGG + Intergenic
903340354 1:22650615-22650637 AATCAATACACCATTTATGTAGG + Intergenic
903752005 1:25629429-25629451 AATAAATTAATTAATTAAGTAGG - Intronic
904281375 1:29421854-29421876 AATAAATTCAGTAAAGCTGTAGG - Intergenic
905005989 1:34710908-34710930 GAACAAGTCAGTGATTATGTTGG - Intergenic
905531752 1:38685368-38685390 AATAAATACAGTATTTATGATGG + Intergenic
906879151 1:49571429-49571451 AATGAATTCAGTAATCATGCAGG - Intronic
906904153 1:49869969-49869991 TATCATTTCATTTATTATGTTGG - Intronic
907368622 1:53982673-53982695 CTTCAATTCAGGAATTCTGTTGG - Intergenic
907994988 1:59621355-59621377 AATAAAAATAGTAATTATGTAGG - Intronic
908834733 1:68217662-68217684 AACCTACTCAGTAATTATTTTGG + Intronic
909389132 1:75097973-75097995 AATCACTCCAGTAATTTTATTGG - Intergenic
909767160 1:79370633-79370655 ATTCAATTCAGTAATTAACATGG - Intergenic
909968147 1:81944066-81944088 AATCAATTCAGCAGTCAAGTAGG - Intronic
910819552 1:91331259-91331281 AATAAATTCAGTAATGTTGCAGG + Intronic
911291979 1:96067783-96067805 AATGAATTCAGTAAAGATGCAGG - Intergenic
911309638 1:96276809-96276831 AATGAATTCAGTAAAGCTGTAGG - Intergenic
911961296 1:104306224-104306246 AAGAAATTCAGTAAATTTGTGGG + Intergenic
911977463 1:104517612-104517634 AATGAATTCAGTAAACTTGTAGG + Intergenic
911993343 1:104731107-104731129 AATAAATTCAGTAATGTTATGGG - Intergenic
912019218 1:105084350-105084372 AATTAATGCAGTAATTACCTAGG + Intergenic
912108453 1:106310771-106310793 AATGAATTCAGTAAATTTGCAGG + Intergenic
912275626 1:108255214-108255236 AATGAATTCAGTAAAGTTGTAGG - Intergenic
912292598 1:108439135-108439157 AATGAATTCAGTAAAGTTGTAGG + Intronic
912772942 1:112481676-112481698 AATGAATTCAGTAAATTTGCAGG + Intronic
912905602 1:113703138-113703160 AAAAAATTCAGTAAGGATGTAGG + Intronic
913938173 1:125075993-125076015 AATCCATTCAATGATTCTGTTGG - Intergenic
913976738 1:143464584-143464606 AATCAATTCTGTAAGTTTCTAGG + Intergenic
914071140 1:144290211-144290233 AATCAATTCTGTAAGTTTCTAGG + Intergenic
914108015 1:144676144-144676166 AATCAATTCTGTAAGTTTCTAGG - Intergenic
915767860 1:158384732-158384754 AAATAATTCAGTAAATTTGTTGG + Intergenic
915898880 1:159832248-159832270 AATTAATTAAATAATTATGAGGG - Intronic
917021533 1:170593662-170593684 AGTCAATTTAGTACTAATGTAGG + Intergenic
917040173 1:170797049-170797071 ATTCAGTTCATTAATTATGAGGG + Intergenic
917946698 1:179980396-179980418 AATGAATTCAGTAAATTTGTAGG - Intronic
919330628 1:196165903-196165925 AATGAATTAAGTAAATGTGTTGG + Intergenic
919522340 1:198603747-198603769 TATCAATTCTGTAATTTTATAGG + Intergenic
921511457 1:216035803-216035825 ACTCAATTCAGTGAGTTTGTTGG + Intronic
921666345 1:217876618-217876640 ATTCAATTAAGGAATTATATAGG + Intergenic
923357468 1:233173792-233173814 TATCAATTCAGACATTTTGTTGG + Intronic
923937478 1:238779212-238779234 AAGAAATTCAGTAAATTTGTAGG + Intergenic
924375053 1:243398608-243398630 AATAAATTTGGTAATTATGATGG - Intronic
1063323454 10:5074007-5074029 AATCAAATATGTAATTATCTCGG - Intronic
1063376816 10:5558901-5558923 ACTAAATTCAGTAAATATTTTGG - Intergenic
1063643349 10:7854113-7854135 AATCATTTCAGTAATGACATCGG - Intronic
1064589917 10:16878738-16878760 AAGTAGTTTAGTAATTATGTAGG - Intronic
1065116402 10:22487475-22487497 AATTAATTCAGTAATTAATTCGG + Intergenic
1065194403 10:23248494-23248516 AGTCAATTCATGATTTATGTTGG - Intergenic
1065708502 10:28493185-28493207 AAGCAATTCAGCAAATATGCAGG + Intergenic
1066493310 10:35916165-35916187 AATCAACTCATTAAGTATTTGGG + Intergenic
1067247769 10:44560600-44560622 AATCAATTCAGTTAATATTTTGG + Intergenic
1068368690 10:56086146-56086168 AACCACTTAAGTAAATATGTGGG - Intergenic
1068662952 10:59642256-59642278 AATGAATTCAGTAAATTTGCAGG - Intergenic
1068942524 10:62693595-62693617 AAGCAAATCAGTGATTATATTGG - Intergenic
1069193116 10:65514964-65514986 AATAAATTCAGTAATGTTGCAGG - Intergenic
1070633845 10:78108165-78108187 AATTAATTAATTAATTATTTTGG + Intergenic
1071064709 10:81617001-81617023 AATCAATACAGTAAGAATGAGGG + Intergenic
1071471741 10:85988366-85988388 GATGAATTAAGTAAATATGTAGG + Intronic
1071759122 10:88580439-88580461 GATCAAAACAGTAATTATGCTGG + Intronic
1072409799 10:95191054-95191076 AACCAATTCAGTAATGCTGCAGG + Intergenic
1073244801 10:102082254-102082276 AATTAATTAATTAATTAAGTTGG - Intergenic
1073743172 10:106435201-106435223 CATGAATTCAGTAGTGATGTTGG - Intergenic
1074739872 10:116475643-116475665 AATTCATTCAGCAAATATGTAGG + Intronic
1075583599 10:123641154-123641176 TATCAATTCCCTAATTTTGTAGG + Intergenic
1077380264 11:2232089-2232111 AATCAATTTAGTAAATTTTTAGG + Intergenic
1077831322 11:5874376-5874398 AATCACACCAGTAATTCTGTTGG - Intronic
1078819952 11:14868644-14868666 AATCAAAACAATACTTATGTAGG - Intronic
1079962906 11:26945896-26945918 AATCAATGCACTCATTCTGTAGG + Intergenic
1080764949 11:35287397-35287419 AATCCATTCAGTCATTTTATCGG - Intronic
1082662539 11:55930007-55930029 AATGAATTCAGTAAACATGCAGG - Intergenic
1082675550 11:56096779-56096801 TATCCATTGAGTTATTATGTTGG + Intergenic
1082690427 11:56296058-56296080 TATCCATTGAGTTATTATGTTGG + Intergenic
1082900376 11:58243299-58243321 AATGAATTCAGTAAATTTGCAGG - Intergenic
1083362858 11:62123449-62123471 AAACAATTTAGAAATTATGATGG - Intergenic
1086088769 11:82983916-82983938 AAGCAAATGAGTAATTATGCTGG + Intronic
1086198433 11:84170290-84170312 AATTTATTCAGTATTTAAGTTGG - Intronic
1086486701 11:87311180-87311202 ACTCAATTCTGGAATTATTTAGG + Intronic
1086877694 11:92116631-92116653 AATAAATTCAGTAAAGATGCAGG + Intergenic
1087364979 11:97207399-97207421 ATTCAATTCAATAAGTATGGGGG - Intergenic
1087927314 11:103934281-103934303 ACTCACTTCAGTAATAATGTGGG - Intronic
1088319666 11:108542575-108542597 AATCAATTTAGTGTTTATGAGGG + Intronic
1091676026 12:2490572-2490594 AATTAGATCATTAATTATGTTGG - Intronic
1092179477 12:6435574-6435596 AATAAATTAATTAATTATCTGGG + Intergenic
1093297987 12:17415744-17415766 AATCAAATCTATAATTATTTTGG + Intergenic
1097440864 12:59606458-59606480 AATGACATCAATAATTATGTTGG - Intronic
1097745466 12:63297391-63297413 AAGCAAATAAGTAATGATGTTGG - Intergenic
1097770317 12:63576580-63576602 GATAAATTCAGTAATGTTGTAGG + Intronic
1098118892 12:67213842-67213864 AAGCAAGTCAGTAATTGTCTAGG + Intergenic
1099091755 12:78319581-78319603 AATGAATTCAGTAAAGTTGTAGG - Intergenic
1100095742 12:91033466-91033488 AAGCAATTCAGGAAATAAGTTGG + Intergenic
1101344804 12:103877167-103877189 AATCAATTGCGTAAATATCTGGG - Intergenic
1101634370 12:106525819-106525841 CAGCAACTAAGTAATTATGTTGG - Intronic
1101787892 12:107901884-107901906 AAGCAAATGAGTAATTATGTTGG - Intergenic
1104154008 12:126113111-126113133 TACCAATTCTGTAAATATGTAGG + Intergenic
1107996032 13:45862001-45862023 AAGCAAATGAGAAATTATGTTGG + Intergenic
1108928177 13:55779078-55779100 AATAAATTCAGTAAAGTTGTAGG + Intergenic
1109494468 13:63149562-63149584 AATTAAGGCAGTAATAATGTTGG + Intergenic
1109574569 13:64236866-64236888 AATGAATTCAGTAAATTTGCAGG + Intergenic
1109617886 13:64860893-64860915 AATAAATTCAGCAAATATTTAGG - Intergenic
1109629537 13:65027754-65027776 AATAATTTCAGTAAATTTGTAGG - Intergenic
1110398618 13:75063785-75063807 AATCTATTAAAAAATTATGTTGG + Intergenic
1111504560 13:89170277-89170299 AATGAATGGAGAAATTATGTAGG - Intergenic
1111606162 13:90542073-90542095 CATTAAATCAGTAATTATTTTGG - Intergenic
1112868624 13:103940307-103940329 AATCATTTCAGAAACTATGTTGG + Intergenic
1112904991 13:104406315-104406337 AATGAATTCAATAATTTTCTAGG + Intergenic
1114205317 14:20565595-20565617 AATGAATTCAGTAAGTTTGCAGG + Intergenic
1114276241 14:21147781-21147803 AATCAGTTCAGCAAATTTGTAGG + Intergenic
1114994332 14:28328971-28328993 AATAAATTCAGTAAATTTGCAGG + Intergenic
1115432518 14:33336367-33336389 AATCAATTCCTTGATTTTGTAGG + Intronic
1115892158 14:38043133-38043155 AGAGAATTCAGTAATTATCTAGG + Intergenic
1116059583 14:39904893-39904915 AATCAATTCATTAATTAATGAGG + Intergenic
1116353188 14:43892728-43892750 AAGCTATTCAATAATTGTGTAGG - Intergenic
1116567049 14:46460980-46461002 AATGAATTCAGTAAATTTGCAGG + Intergenic
1116634066 14:47371737-47371759 AATCAATACAGAAACTATCTTGG - Intronic
1117422967 14:55565701-55565723 AATGAATTCAGTAAATTTGCAGG - Intronic
1118146860 14:63147048-63147070 AATAAATCCAGTAAATTTGTAGG - Intergenic
1119183922 14:72623566-72623588 CATCAAATGAGTAATTATGTTGG + Intronic
1119640679 14:76312409-76312431 AATCCATTCATTCATTATTTTGG + Intronic
1119866139 14:77976549-77976571 TATCAGTTCAGTAAATAAGTGGG + Intergenic
1120012389 14:79432054-79432076 AATTAATTCGGTAATTATTGAGG - Intronic
1120107275 14:80510472-80510494 AACCAATTCAGTAAATTTGAAGG - Intronic
1120123195 14:80707726-80707748 AATCAAATGATTAATTATATAGG - Intronic
1120239633 14:81935192-81935214 AATGAACTCTGTAAGTATGTAGG + Intergenic
1120604385 14:86555408-86555430 AATGAATTCAGTAAAGTTGTAGG - Intergenic
1124019614 15:25908499-25908521 TATCACTTCAGTAAATGTGTAGG + Intergenic
1124043277 15:26124672-26124694 AATCAATTCAGTATTTGAATAGG + Intergenic
1125044963 15:35234746-35234768 AAGTAATTCAGTATTTTTGTTGG + Intronic
1126855338 15:52833407-52833429 AATCAGTTCACTAACAATGTAGG - Intergenic
1127227639 15:56950159-56950181 AACCAGATCAGTAGTTATGTGGG - Intronic
1128014932 15:64335512-64335534 AATCAAGTCAGTAATTTCTTGGG - Intronic
1129075018 15:72986799-72986821 AATGAATTCAGTAAAACTGTAGG + Intergenic
1129642841 15:77398896-77398918 AATAAATTCAGTAAAGTTGTAGG + Intronic
1129925668 15:79361767-79361789 CATTAATTTAGTAATTATTTGGG - Intronic
1130203303 15:81853117-81853139 AAGCAACTCAGAATTTATGTGGG - Intergenic
1131190479 15:90311858-90311880 AATCAATTCAGTAAAGTTGCAGG - Intronic
1131562176 15:93454423-93454445 AATAAAATCAGTAATTCTCTGGG + Intergenic
1133631425 16:7625668-7625690 TTTAAATTCAGAAATTATGTAGG + Intronic
1135730769 16:24893300-24893322 AATTAATTAATTAATTATGCCGG + Intronic
1135796836 16:25452768-25452790 AATCAAATGAGTAATTACATCGG - Intergenic
1136637513 16:31534302-31534324 AATCAATACAGTAATTTTCAAGG - Intergenic
1136727681 16:32374168-32374190 AATTAATTGACTATTTATGTGGG + Intergenic
1140764416 16:78143577-78143599 AATAAATGCAGTAAATATCTTGG - Intronic
1141363148 16:83416035-83416057 AATGAATTTAGTAAATTTGTGGG + Intronic
1203130351 16_KI270728v1_random:1679990-1680012 AATTAATTGACTATTTATGTGGG - Intergenic
1144464406 17:15485493-15485515 AATTAATACATTAATTATGTGGG - Intronic
1146433015 17:32816469-32816491 AATCATTTTAATAATTATTTTGG + Intronic
1147497324 17:40929079-40929101 GATCAAGTCAGTAATCATGGAGG - Intronic
1149041852 17:52199304-52199326 AATAAATTCAGTAAACTTGTAGG + Intergenic
1150879462 17:69007113-69007135 AATCTATTCAGAAATGATGAAGG + Intronic
1203184940 17_KI270729v1_random:106605-106627 AGTCAATTCAGTAATTGCTTTGG + Intergenic
1153248190 18:3094321-3094343 AATAAACACAGTAATTATATTGG + Intronic
1153433724 18:5046831-5046853 AATCATTTCTGGAATTAAGTGGG - Intergenic
1153570836 18:6472101-6472123 AATCATTTTAGTTATTATATTGG - Intergenic
1153878738 18:9402067-9402089 AATCTATTCTGTGTTTATGTAGG + Exonic
1155137388 18:23009219-23009241 AATAAATTAAGGAATTATGTTGG - Intronic
1155655917 18:28193239-28193261 ACTATATTCATTAATTATGTTGG + Intergenic
1155719519 18:28993412-28993434 AATCAATTCATTCATTATTGTGG - Intergenic
1155862806 18:30924995-30925017 AAGCAAGTAAGTAAATATGTAGG - Intergenic
1156844525 18:41649162-41649184 AATTAATTCATTCATTATGTTGG + Intergenic
1158049419 18:53198684-53198706 AACAAATTAAGTACTTATGTTGG - Intronic
1162368262 19:10262756-10262778 AATTAATTCATTAATTAAATAGG + Intergenic
1165148067 19:33744723-33744745 AATCAATTAATTAATTAGGTGGG - Intronic
1165566858 19:36737101-36737123 AATGAATTCAGTAATGTTGCAGG + Intronic
1166414647 19:42585876-42585898 AATAAATTCAGTAATGTTGCAGG + Intronic
1166424624 19:42665861-42665883 AATAAATTCAGTAATGTTGCCGG - Intronic
1166763742 19:45240263-45240285 AATTAATTAATTAATTAAGTGGG - Intronic
925028871 2:633997-634019 ACTCAATTCAGTAATTACAGAGG - Intergenic
925945778 2:8862085-8862107 AAACAATTGAGAAATTAGGTTGG - Intronic
925954272 2:8946743-8946765 TATCAATTAAGTTCTTATGTGGG - Intronic
926393890 2:12422141-12422163 AATAAATTCAGTAGTAATATTGG + Intergenic
926640630 2:15232089-15232111 AATCAATACAGTTAATGTGTTGG + Intronic
928007784 2:27579340-27579362 AATCTATTCAGAATTTATTTGGG + Exonic
928996592 2:37298779-37298801 AATGAATTAAGTAAAGATGTAGG - Intronic
930172954 2:48270008-48270030 AATTAATTCTGTTAATATGTTGG - Intergenic
930427943 2:51234860-51234882 AAGCAATTCAATAAGTATCTAGG + Intergenic
931358518 2:61557928-61557950 AATCAAAGCATTCATTATGTAGG - Intergenic
931507346 2:62944625-62944647 AATATATTGATTAATTATGTGGG - Intronic
931593589 2:63914715-63914737 CATCAATTCATTAGTTATGATGG - Intronic
931678352 2:64720585-64720607 AATCATGTCAGTAACTATGAGGG + Intronic
932148106 2:69342479-69342501 AATAAATACTGTAATTGTGTGGG - Intronic
934043766 2:88153547-88153569 AATAAATTCAGTAATGTTGCAGG + Intergenic
934053801 2:88234670-88234692 AATCAATCTAGAAATTATATTGG + Intergenic
934181438 2:89625552-89625574 AATCAATTCTGTAAGTTTCTAGG + Intergenic
934291741 2:91699789-91699811 AATCAATTCTGTAAGTTTCTAGG + Intergenic
935341960 2:102066488-102066510 AATCAAACCAATAATTTTGTAGG - Intronic
935397275 2:102621165-102621187 AATCAATTAATTAATTAATTAGG + Intronic
935841125 2:107111646-107111668 ATTCAATTCCAAAATTATGTAGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936854708 2:116942876-116942898 AATCATTTCAGCAATTATATGGG + Intergenic
937570113 2:123347225-123347247 AATGAATTCAGCAAAGATGTAGG + Intergenic
937760715 2:125599852-125599874 AATGAATTCAGTTATGATTTTGG - Intergenic
937777591 2:125798009-125798031 AATTGATTCAGTAAATTTGTCGG + Intergenic
938154959 2:128928063-128928085 AATCAATTGGGTAAATATGTAGG + Intergenic
938862808 2:135387698-135387720 AAGTAATTAAGTAATTATGATGG + Intronic
939061398 2:137425968-137425990 AATGAATTCAGTAAATTTGCAGG + Intronic
940091251 2:149920953-149920975 AATGAATTCAGTAAAGTTGTAGG + Intergenic
940108630 2:150126239-150126261 AATCAAATCAGAAATTTTCTGGG - Intergenic
940466624 2:154037643-154037665 AATGAATTCAGTAAAGTTGTAGG + Intronic
940506573 2:154562095-154562117 AATGAATTCAGTACATTTGTGGG - Intergenic
940668972 2:156644400-156644422 AGTGAATTCAGTAAATTTGTAGG + Intergenic
941215063 2:162696292-162696314 AATGTTTTTAGTAATTATGTTGG + Intronic
941317653 2:164014707-164014729 AATGAATGCAGTGATTATATTGG + Intergenic
941500350 2:166266907-166266929 AATGAATTCAGTAATGTTGGAGG - Intronic
941568496 2:167139857-167139879 AATGAAATTAGCAATTATGTTGG - Intronic
941614899 2:167707984-167708006 AATCACTTCAGGAATTCTGGTGG + Intergenic
941656540 2:168150767-168150789 AAGCAAGTCAATAAATATGTTGG + Intronic
942609967 2:177733233-177733255 TATTAATTCAGTAGTTATTTTGG - Intronic
942899705 2:181099814-181099836 AATAAATTCAGTAAAGTTGTAGG + Intergenic
943033464 2:182713235-182713257 AAACAAATCTGTAATTATGAAGG - Intergenic
943115308 2:183662010-183662032 AATTAAATGAGTAATTATATTGG + Intergenic
943168902 2:184370755-184370777 AATCAGTTGAGTAATTACCTAGG - Intergenic
943372295 2:187029750-187029772 AAGAAATTCAGTAATTTTGAAGG + Intergenic
943532573 2:189102718-189102740 AAAAGGTTCAGTAATTATGTTGG + Intronic
943706922 2:191045667-191045689 TAACAATTCTGTGATTATGTGGG + Intronic
944372859 2:199006896-199006918 AATAAATTCAGTAAAGTTGTAGG - Intergenic
944467706 2:200020030-200020052 TATCAAATAAGTAATTATGTAGG - Intergenic
944621647 2:201522294-201522316 AATGAATTCAGTAAAAATGAAGG + Intronic
945824473 2:214703924-214703946 AATGAATTCAGTAAAGTTGTAGG + Intergenic
946684383 2:222252770-222252792 AATTAATTCATAAATTAAGTTGG - Intronic
947308048 2:228768888-228768910 AATAAATACATAAATTATGTAGG + Intergenic
947376204 2:229498552-229498574 AATGAATTCAGTAAATATGGAGG + Intronic
947532243 2:230917452-230917474 AAAAAATTCAGAAATTATTTTGG + Intronic
947579275 2:231303163-231303185 AATAAATTCAGTAAGGTTGTAGG - Intronic
948016548 2:234695671-234695693 AAGCAAATCAGTAATGATGCTGG - Intergenic
1169329743 20:4706915-4706937 AATCAATTCAAAAATTATAGTGG + Intergenic
1170143615 20:13149395-13149417 AATGATTTTATTAATTATGTTGG - Intronic
1170977377 20:21178431-21178453 AATGAATTCAGTAAAGTTGTAGG - Intronic
1173708451 20:45133327-45133349 AGTCTCTTCAGTAATAATGTTGG - Intergenic
1173720117 20:45250996-45251018 AATGAATTCAGTAAATATGCAGG + Intergenic
1174876940 20:54236849-54236871 AATGAAATCAATAATTAAGTTGG - Intergenic
1174967715 20:55237671-55237693 GATTAATTCAGTTAATATGTGGG + Intergenic
1175107556 20:56626116-56626138 AATCATTTTTGTAATTATTTTGG + Intergenic
1175573767 20:60044530-60044552 AATAAATTCAGTAAATTTGCAGG - Intergenic
1175638339 20:60604098-60604120 ACTCAATTCAGTCATTATAGAGG - Intergenic
1175736844 20:61393072-61393094 AATCAATTCAGTAAGAAATTAGG - Intronic
1176176070 20:63725313-63725335 AACCAATTCAGTGTTTATTTGGG + Intronic
1177177679 21:17717769-17717791 AATGAATTCAGTAAGTATATTGG + Intergenic
1177367589 21:20157494-20157516 TATCTATCCAGTAATAATGTTGG - Intergenic
1177408006 21:20695175-20695197 AATTAATTAATTAATTATTTGGG - Intergenic
1178154915 21:29840666-29840688 AATAAATTCAATAATTGTTTTGG + Intronic
1178211902 21:30544578-30544600 AAACAATTCAGTAAATTTGCAGG - Intronic
1180306472 22:11130589-11130611 AATTAATTGACTATTTATGTGGG - Intergenic
1180544991 22:16492772-16492794 AATTAATTGACTATTTATGTGGG - Intergenic
1184956691 22:47891911-47891933 AATGAAGTCAGTAAATATTTGGG - Intergenic
949216162 3:1570314-1570336 AATCAAATCAGTAATAAATTTGG + Intergenic
950575734 3:13831029-13831051 AATCACTACTGTGATTATGTAGG + Intronic
952548917 3:34453778-34453800 AAACAATTCAGTAAATTTGCAGG - Intergenic
952677239 3:36047986-36048008 GATAAATTCAGTAAATTTGTGGG - Intergenic
953107369 3:39897071-39897093 AATCAATTCAGTAATTATGTTGG + Intronic
953317830 3:41945001-41945023 AATCAATTCTGGAATTATGTAGG - Intronic
953711965 3:45280678-45280700 AATAAATTCAGTAAATTTGCAGG + Intergenic
954757058 3:52846393-52846415 AAACCATTAAGTAATTAAGTAGG + Intronic
956041173 3:65146695-65146717 ATTGAATTTAGTAATTATCTTGG - Intergenic
956944515 3:74204752-74204774 AACCAATTCAATTATGATGTTGG - Intergenic
957436621 3:80185656-80185678 AATCTAATCAATAAATATGTAGG + Intergenic
957749418 3:84393416-84393438 TATGTATTCAGTAATTATGAAGG - Intergenic
958070275 3:88601394-88601416 AAGCCATTCAATAATTATATTGG - Intergenic
958084696 3:88791641-88791663 AATAAATTCAGTAAATTTGAAGG - Intergenic
958544720 3:95529855-95529877 AAAGAATTCAGTAACAATGTAGG - Intergenic
958620101 3:96547749-96547771 AATCAATTCTCTAATTATCATGG - Intergenic
958630796 3:96680936-96680958 AATAAATTCAGTAAAGTTGTAGG - Intergenic
958891492 3:99788404-99788426 CATCAATTCAGTGGATATGTTGG - Intronic
959590961 3:108080605-108080627 AATAAATTCAGCAACTATGTTGG + Intronic
960206994 3:114914428-114914450 AATAAATTCAGTAAATTTGCAGG - Intronic
960251144 3:115455003-115455025 AATCAGTTGAGTAAATATCTAGG + Intergenic
961742739 3:129043856-129043878 AATGAATTCACTATTTTTGTTGG + Intergenic
962700523 3:137994576-137994598 AATGAATTCAGTAATGTTGCAGG - Intergenic
964630062 3:158800923-158800945 AAGAAAATCAGTAATTATTTAGG - Intronic
964707843 3:159639440-159639462 AATGAATTGAGTAATTAAGATGG - Intronic
964977107 3:162634812-162634834 AATCATATCAGTAGTGATGTGGG + Intergenic
965452306 3:168853004-168853026 AATAAATTCAGTAAATTTGCAGG - Intergenic
965471365 3:169096826-169096848 AATCAAATCAGTACTTGTGTTGG - Intronic
965789536 3:172372844-172372866 AGTCAATGCAATATTTATGTTGG - Intronic
966308434 3:178564383-178564405 AAGAAATTCAGTGCTTATGTAGG + Intronic
966384709 3:179383875-179383897 TATCAATTCAGTAATTTTTTAGG + Intronic
966513849 3:180794979-180795001 AATGAATTCAGTAAAGTTGTAGG - Intronic
967726677 3:192868947-192868969 AATACATTAAGTAATTAGGTAGG + Intronic
968246073 3:197149494-197149516 ATTTAATTCAGAAATTATGATGG - Intronic
970470440 4:16372942-16372964 AATCAATTCAGTAAGTGGGTAGG + Intergenic
971073447 4:23121598-23121620 AATCAATTCAGAAAGGAGGTGGG - Intergenic
971590690 4:28465375-28465397 AATCAATTCAGTAAAGTTGCAGG + Intergenic
971912416 4:32810971-32810993 AAGCCATTCAGTAAGTCTGTAGG + Intergenic
973345868 4:49054853-49054875 AATAAATTCAGTAAATTTGCAGG - Intronic
973838113 4:54831437-54831459 ATTTAATTCTTTAATTATGTAGG - Intergenic
974566834 4:63589293-63589315 AACCAATTAAGTAAGTATCTAGG - Intergenic
975253026 4:72201341-72201363 AATCAATTGAGTTATTTTGTGGG + Intergenic
975363210 4:73496290-73496312 AATAAATTAAATAATTATGATGG - Intronic
976161566 4:82206053-82206075 AATAAATTCAGTAAATTTGCAGG + Intergenic
977034896 4:91937452-91937474 AATCAATCCTGAAATTATGATGG + Intergenic
977187127 4:93953324-93953346 AATGAATTCAGTAAAGTTGTAGG + Intergenic
977459157 4:97302675-97302697 AATGAATTCAGTAAAGATGCAGG + Intronic
977547262 4:98398718-98398740 AATGAATTCAGTAATGTTGCAGG + Intronic
977926851 4:102710296-102710318 AATAAATTCAGCAAATTTGTAGG + Intronic
977950779 4:102968194-102968216 AATCAATTGACTATTTATGTGGG - Intronic
978305650 4:107325262-107325284 AATCACTTCAGAAAACATGTGGG + Intergenic
978655096 4:111056174-111056196 GATAAATTCAGTAAATTTGTAGG + Intergenic
978655280 4:111058830-111058852 AAACAAACCAGTAATTTTGTTGG - Intergenic
979682226 4:123474071-123474093 AAAAAATTGGGTAATTATGTGGG - Intergenic
979701603 4:123674411-123674433 AAATAATTCATTAATTATTTTGG - Intergenic
980190389 4:129517333-129517355 AATGAATTAAATAATTTTGTAGG - Intergenic
980483325 4:133419054-133419076 GATGAAGTCAGAAATTATGTGGG + Intergenic
980622280 4:135323432-135323454 AATGAACTCAGTTACTATGTTGG + Intergenic
980631561 4:135442826-135442848 AATTAATTCAGTAAATGTGAAGG + Intergenic
980944249 4:139303113-139303135 AATGAATTCACTAAATCTGTAGG - Intronic
981200633 4:141975362-141975384 AATCACTGCTGTAATTATTTTGG + Intergenic
981356520 4:143795688-143795710 AATCAATTAAGTGCTTATATTGG - Intergenic
981734239 4:147933046-147933068 AATCAATTCAGAAATTTATTGGG - Intronic
982439062 4:155413482-155413504 ATTCAATTCATGAATGATGTTGG + Intergenic
982494942 4:156078495-156078517 AATGAATTCAGTAAAAATGAAGG - Intergenic
982629800 4:157818731-157818753 AACCATTTCGGTAATAATGTTGG - Intergenic
982916418 4:161215252-161215274 AATGAATTCAGTAAATTTGCAGG - Intergenic
983633041 4:169869306-169869328 AATGAATCCAGTACATATGTAGG - Intergenic
983722914 4:170880233-170880255 ATTCACTCCAGTCATTATGTAGG + Intergenic
984085495 4:175305736-175305758 AATCATCTCAGTAACTTTGTAGG + Intergenic
984429543 4:179630252-179630274 AATTAATTCAATACTTATGTTGG + Intergenic
984750615 4:183269664-183269686 AGTGAATTATGTAATTATGTGGG - Intronic
986114300 5:4754951-4754973 AATCAGTTCAGTACATATCTAGG + Intergenic
987091859 5:14515148-14515170 ATTCAGTTCAGCAAATATGTGGG - Intronic
987439356 5:17937040-17937062 AATCAATTCAGTAAATTTGCGGG + Intergenic
987537975 5:19212773-19212795 AATGAATTCAGTAAATTTGCAGG + Intergenic
988041577 5:25894808-25894830 AATCAATTCATACATCATGTGGG + Intergenic
988642324 5:33054479-33054501 AATGAATTCAGTAAAGTTGTAGG + Intergenic
989392891 5:40921100-40921122 AATTAATTCAGTAAATTTGCAGG + Intronic
990787443 5:59438220-59438242 AATCATATCAGTAATTCTGTTGG + Intronic
990925622 5:61018452-61018474 AATCCAATCAGTATTTATGTTGG + Intronic
992035039 5:72764952-72764974 AAGCAAATGAATAATTATGTTGG + Intergenic
992060611 5:73042738-73042760 AATCAATACAGAAAATAAGTGGG + Intronic
992708860 5:79428576-79428598 AATGAGTTCAGTAAGTTTGTAGG + Intronic
992951694 5:81864525-81864547 AATCAACTCACTAAATATTTTGG - Intergenic
993026216 5:82649995-82650017 GATCAATTCAGTCAATTTGTTGG + Intergenic
993512731 5:88792130-88792152 AATTAATTTACTAATTATATAGG + Intronic
993914085 5:93720319-93720341 AAACAATTCAATCATTATATTGG + Intronic
994308086 5:98231454-98231476 AATGAATTCAGTAAATTTGCGGG + Intergenic
994557796 5:101326700-101326722 AACCAATTGAGTAAATATGTAGG + Intergenic
996449016 5:123596902-123596924 AATGAATTCAGTCTTTATTTTGG - Intronic
997141458 5:131385635-131385657 AATGAATTCAGTAAGTATGTTGG + Exonic
997671331 5:135676059-135676081 AATAAATTCAGTAATGTTGCAGG - Intergenic
999593521 5:153175625-153175647 AATGAATTCAGTAAATTTGCAGG - Intergenic
999774051 5:154797634-154797656 AACAAAATGAGTAATTATGTTGG - Intronic
1000408152 5:160910659-160910681 AATCAGTTCAGTAATTTTTGAGG + Intergenic
1000864495 5:166496048-166496070 GATAAATTAAGTAAATATGTAGG - Intergenic
1004005467 6:11633816-11633838 CATCAATTCAGAAATTCTCTGGG - Intergenic
1004039220 6:11959387-11959409 AATCAATGCAGTAAAAATCTGGG - Intergenic
1004795382 6:19077401-19077423 AATTAATTCAGTAAATTTGCAGG + Intergenic
1007190746 6:40015696-40015718 GATAAATTCAGTAATTTTGCAGG - Intergenic
1007682467 6:43644044-43644066 AATCAAAAAAGTAATTATCTGGG + Intergenic
1007726438 6:43918930-43918952 AATCAATTGAGTAAATACGTAGG - Intergenic
1008318433 6:50076525-50076547 AATGAATTCATTCATAATGTAGG + Intergenic
1008418708 6:51272291-51272313 AAGCACTTCAGTAATAATATTGG + Intergenic
1009281302 6:61755254-61755276 GATCAATTCAGTCATAATGTTGG - Intronic
1009321095 6:62289396-62289418 AATCAATTCAGTGGTGATTTAGG - Intergenic
1009592992 6:65698393-65698415 AATCGATGCATTAATTATATAGG - Intronic
1009734011 6:67651521-67651543 GATTTCTTCAGTAATTATGTAGG - Intergenic
1010501509 6:76607071-76607093 AATGAATTCAGTAAAGTTGTGGG + Intergenic
1010613631 6:77986054-77986076 AATCAATTCAGTATATAAATGGG + Intergenic
1011036618 6:82983689-82983711 AGTCAAATGAGCAATTATGTTGG - Intronic
1011161703 6:84397932-84397954 AATCTGTTCAGAAATTAGGTAGG - Intergenic
1011240359 6:85265882-85265904 AATCTATTCATTACATATGTTGG + Intergenic
1011730589 6:90258912-90258934 AATGAATTCAGTAAAGCTGTGGG - Intronic
1012056665 6:94421151-94421173 AATGAATTTAGTAAAAATGTAGG - Intergenic
1012106219 6:95162643-95162665 TATTAATTCAGTAATTAAATTGG + Intergenic
1012341230 6:98126871-98126893 AATCAATTCAGTGATTTTCAAGG - Intergenic
1013119349 6:107127382-107127404 AATATGTTCAGTAAGTATGTGGG - Intergenic
1013783228 6:113751583-113751605 AATCAATTCAGTAAAGTTGCAGG + Intergenic
1014449134 6:121563169-121563191 AATTAATTAATTAATTATTTTGG + Intergenic
1015151333 6:130042045-130042067 AAACAAATAAGTAATTATGTTGG - Intronic
1015443773 6:133279334-133279356 AATCAATTCACTTATATTGTTGG + Intronic
1015517614 6:134099705-134099727 ATTCAATTCAGTAATTCTTTTGG - Intergenic
1015837770 6:137440151-137440173 AATAAATTCAGTAAATTTATAGG - Intergenic
1016360999 6:143267346-143267368 AATCAATCCAGTAAGTGTTTTGG - Intronic
1016591343 6:145747652-145747674 AATGAATTCAGCAAATTTGTAGG + Intergenic
1016621464 6:146114032-146114054 AACAAATATAGTAATTATGTAGG - Intronic
1016742748 6:147545970-147545992 AATCAAATGAGAAAATATGTGGG + Intronic
1017742465 6:157418916-157418938 TAGCAATTCAGTTATTATATTGG + Intronic
1017880242 6:158557817-158557839 GGTCAATTAAGTAATTATTTAGG + Intronic
1018303777 6:162431879-162431901 AATAAATTCACTAATTACTTTGG - Intronic
1020481345 7:8665864-8665886 AATCAATTCAGTAAAGTTGCAGG - Intronic
1020649125 7:10854161-10854183 AAGCAAATAAGTAATTCTGTTGG + Intergenic
1021106893 7:16647305-16647327 AAATATTTGAGTAATTATGTAGG + Intronic
1021432820 7:20580785-20580807 AATCCAGTAAGTAATTATTTAGG + Intergenic
1022293560 7:29027615-29027637 AATGAATTCAGTAAAGTTGTAGG + Intronic
1022366592 7:29726286-29726308 GATAAATTCAGTAATGGTGTAGG - Intergenic
1024171847 7:46796237-46796259 AATCAGTTCAGTAAATATCTAGG + Intergenic
1024428003 7:49251039-49251061 GAACAAATCAGTAAATATGTTGG - Intergenic
1024609095 7:51047862-51047884 AAGCATTTCAATAATTTTGTGGG + Intronic
1024621920 7:51167234-51167256 AATAAATTCAGTAATGTTGCAGG + Intronic
1025322559 7:58112315-58112337 AGTCCATTCAGTAAATCTGTTGG + Intergenic
1025474835 7:60906201-60906223 CACAAATTCAGTAATCATGTGGG - Intergenic
1025512168 7:61583673-61583695 CACAAATTCAGTAATCATGTGGG + Intergenic
1025560210 7:62363780-62363802 AATTAATTCATTAATTATTGGGG + Intergenic
1026459403 7:70600230-70600252 GTACAATTCAGTAATTTTGTGGG + Intronic
1027476828 7:78642489-78642511 AATATATTCAGTAATCATTTAGG + Intronic
1027807055 7:82840356-82840378 AATCAATTAAGTGATTATCCAGG - Intronic
1027969442 7:85059541-85059563 ATTCAATTCAATCATTTTGTAGG - Intronic
1027996495 7:85432106-85432128 AATGAATTCAGTAACACTGTAGG + Intergenic
1028049573 7:86165454-86165476 AATGAATTCAGTAATAGTGTAGG - Intergenic
1028741165 7:94277486-94277508 AATCAAGTCAGTCTTTATCTAGG - Intergenic
1029825683 7:103191260-103191282 GATAAATTCAGTAATGTTGTAGG + Intergenic
1030471560 7:109970072-109970094 AATGAATTCAGTAAATTTGCAGG + Intergenic
1030619171 7:111770675-111770697 ATTCAATTGAGTAATTGAGTAGG - Intronic
1031289038 7:119908847-119908869 AAGCCATTCAATAATTATGTAGG + Intergenic
1032412704 7:131709813-131709835 AATCAAATGAGAAATTTTGTGGG - Intergenic
1034154302 7:148942195-148942217 TATAAATTCAATAATTGTGTAGG + Intergenic
1035357627 7:158286210-158286232 AATAAATTCAGTAAATTTGCAGG - Intronic
1036984089 8:13506984-13507006 ATTCAATTCAGTAAGTGTTTTGG - Intronic
1037386631 8:18350222-18350244 AATAAATTCAGTAAGTTTGCAGG + Intergenic
1037453886 8:19044482-19044504 AATCTATTCAACAATCATGTAGG - Intronic
1038015656 8:23512380-23512402 AATCTCATCAGTAATTATTTTGG + Intergenic
1039663834 8:39497690-39497712 AACAAATTCAGTAAATTTGTAGG + Intergenic
1039701212 8:39963648-39963670 AATCAATTGAGGAAGTTTGTTGG - Exonic
1040899019 8:52398274-52398296 AATGAATTCAGTACATTTGTAGG - Intronic
1041309850 8:56505113-56505135 AATTAATTGAGCAATTATCTTGG - Intergenic
1042057626 8:64782641-64782663 AATCAATTCAAAAGTTATGTTGG - Intronic
1042073473 8:64962006-64962028 AATAAATTCAGTAAAGCTGTAGG + Intergenic
1043285697 8:78527199-78527221 AATCAGTTCAGTATTTAAATAGG - Intronic
1043496394 8:80805419-80805441 TATCAATTCTGGAATTATGGGGG + Intronic
1043616701 8:82134078-82134100 AATGAATTCAGTAATGTTTTGGG + Intergenic
1043708732 8:83385812-83385834 AATGAATTCAGTAAATTTGCAGG + Intergenic
1045229766 8:100292751-100292773 AATTAAATCAGTATGTATGTAGG - Intronic
1045991967 8:108318511-108318533 AATCAAATGAGTAATTATGTTGG - Intronic
1046292322 8:112179364-112179386 ATACAATTCAGATATTATGTAGG - Intergenic
1046388099 8:113530119-113530141 AATTAATTCAGTAAATACATAGG + Intergenic
1046921246 8:119731794-119731816 AATGAATTCAGAATTTCTGTAGG + Exonic
1048119155 8:131560352-131560374 AACAAATTCAGTAAATTTGTAGG + Intergenic
1051222109 9:14859812-14859834 AGTCAATCCAGAAATTATATAGG - Intronic
1051555806 9:18381191-18381213 AATCACTACATTAATTATCTGGG + Intergenic
1052580822 9:30351377-30351399 AATAAATTCAATAAATGTGTAGG - Intergenic
1053460575 9:38267067-38267089 AATGAATTCAGTAATGTTGCAGG + Intergenic
1055737971 9:79353170-79353192 AAATAATTCAGTCTTTATGTAGG + Intergenic
1055738421 9:79358612-79358634 TATCAATAGAGTAATAATGTAGG - Intergenic
1056261936 9:84857646-84857668 AATTAACTCAGTCATTATGTAGG - Intronic
1057021655 9:91703272-91703294 AATTAATTCAGTAAAATTGTAGG - Intronic
1057823065 9:98348776-98348798 AATAAATTCAGTAAAGTTGTAGG - Intronic
1058098796 9:100894410-100894432 AATCAATTTAATAATCATTTAGG - Intergenic
1058398115 9:104579614-104579636 AATCATAACATTAATTATGTAGG - Intergenic
1059004824 9:110390749-110390771 AATTAATTCAATATTTCTGTGGG - Intronic
1059128244 9:111715847-111715869 AATAAATTCAGTATTTATTATGG - Intronic
1059638522 9:116193357-116193379 GATCAAATCAGAAATTAAGTAGG - Intronic
1187610303 X:20936072-20936094 AACTAATTCAGTAATGTTGTGGG - Intergenic
1187729176 X:22235223-22235245 AATCAATGCAGAAAGTAAGTGGG - Intronic
1188014513 X:25093431-25093453 AATGAATTCAGTAAAGATGCAGG - Intergenic
1188140532 X:26545033-26545055 AATCAATCCAATATTAATGTAGG + Intergenic
1188213432 X:27450099-27450121 ACTAAATTGAGCAATTATGTGGG - Intergenic
1188353142 X:29156912-29156934 AATCCATTCTGTAATTATTTTGG - Intronic
1188426687 X:30055914-30055936 AATAAATTCAGTAAATTTGCAGG - Intergenic
1188981646 X:36732248-36732270 AATGAATTCAGTAAGTACATGGG - Intergenic
1189019962 X:37325002-37325024 AATCAATTCAGTAAAGTTGCAGG + Intergenic
1190402338 X:50050197-50050219 AATCAAGTAAGTAAGTATTTAGG + Intronic
1190501857 X:51087022-51087044 ACTCAATTAAGTAATTAATTGGG + Intergenic
1191763957 X:64675995-64676017 AATGAATTCAGTAAAGTTGTAGG + Intergenic
1191983795 X:66956503-66956525 AATGAATTCAGTAATAATGCAGG - Intergenic
1192734459 X:73835716-73835738 AATCTAAGCAGTGATTATGTAGG + Intergenic
1193358202 X:80548216-80548238 AATGAATTCAGTAATGTTGCAGG - Intergenic
1193816375 X:86108887-86108909 AATAAATTCAGTAATGTTGCAGG + Intergenic
1194294973 X:92116212-92116234 AATCCATTCAGACATTATTTTGG + Intronic
1194330230 X:92574073-92574095 AATTATTTCAGTAACAATGTGGG + Intronic
1194732326 X:97470588-97470610 AATCCATTCAGAAATCATATTGG + Intronic
1196381505 X:115095991-115096013 AATAAATTCAGTAAAGCTGTAGG + Intergenic
1196577592 X:117338171-117338193 AATAAATTCAGTAAAAATGCAGG - Intergenic
1196755955 X:119157420-119157442 GTTCAATTCAGTAATTGAGTAGG - Intergenic
1197062529 X:122198404-122198426 AATAAATTCAGTAAAGGTGTAGG + Intergenic
1197260959 X:124317416-124317438 AATGAATTCAGTAAATTTGCCGG + Intronic
1197567385 X:128104060-128104082 AATGAATTCAGTAAAGTTGTAGG - Intergenic
1197926673 X:131654312-131654334 AATAAATTCAGTAAAGTTGTAGG - Intergenic
1198517106 X:137420659-137420681 AAGGGATTCAGTAAATATGTGGG - Intergenic
1199652670 X:149962437-149962459 AATTAATTCTTTAAATATGTCGG - Intergenic
1199866746 X:151857718-151857740 AATGAATTCAGTAAATTTGCAGG + Intergenic
1200409655 Y:2848770-2848792 AAAAAATTCAGTAATTTTTTTGG + Intronic
1200612466 Y:5340732-5340754 AATCCATTCAGACATTATTTTGG + Intronic
1200638939 Y:5693252-5693274 AATTATTTCAGTAACAATGTGGG + Intronic